Caenorhabditis Genetics Center (CGC)

Search Strains

More Fields
Strain Species Genotype Add
RB853 C. elegans T14G12.4(ok683) X. Show Description
T14G12.4. Homozygous. Outer Left Sequence: AATAATCGACGTTTGACGGC. Outer Right Sequence: TAATCATCCTTGGAAACGCC. Inner Left Sequence: TTGGTGTTACAAGCACGGAA. Inner Right Sequence: ATCGCAGTGGTTAGTCCCAC. Inner primer WT PCR product: 2102. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
OP185 C. elegans unc-119(ed3) III; wgIs185. Show Description
wgIs185 [fkh-2-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
PS9589 C. elegans fkh-2(sy1839) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of fkh-2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCCATCAAAGACAGTCCAGAAAAACGTCTCACATT. Right flanking sequence: GGCTGGAATTTACGAATACATCGTCACCAATTACC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GAAAAACGTCTCACATTGGC Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.