Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
PS8540 C. elegans dod-17(sy1392) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dod-17. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGTAATTGATGGTACGCCTGTATATTGGCCAGCT right flanking sequence: GCTTGGAACGAGACTCAGCCTGCTCCTCAGCTGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGAGTCTCGTTCCAAGCAGC Method Reference: G3 (Bethesda).
RB1845 C. elegans dod-17(ok2387) IV. Show Description
K10D11.1. Homozygous. Outer Left Sequence: GTGCAAAGACCACCGATTTT. Outer Right Sequence: CTTGAGAGCGCCTTTCACTC. Inner Left Sequence: GACAAAACGCCCAGTTTCAT. Inner Right Sequence: CTTTGCTTCTATGTCGGCGT. Inner Primer PCR Length: 2109 bp. Deletion Size: 1489 bp. Deletion left flank: TTCATCTGTCTAGCGTTTGCTACTGCAATT. Deletion right flank: AATCGATGAGATGGTGGAACTCCGGCCGCA. Insertion Sequence: CGATGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
CF2038 C. elegans muEx312. Show Description
muEx312 [dod-17p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.