Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
PS8884 C. elegans dmsr-14(sy1553) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-14; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGTTTATTGCTGTTAGTGATTTCGGATGTGCAGT Right flanking sequence: TACTGGTTTGATGCAATTATTTATAAGAAATTATTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GATTTCGGATGTGCAGTTAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
CHS1167 C. elegans dmsr-9(yum1992) dmsr-10(yum1993) dmsr-11(yum1994) dmsr-12(yum1995) dmsr-13(yum1996) dmsr-14(yum1997) dmsr-15(yum1998) dmsr-16(yum1999) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.