Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC566 C. elegans cox-6A(gk274) III. Show Description
F54D8.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
BC12515 C. elegans dpy-5(e907) I; sIs11147. Show Description
dpy-5(e907)/dpy-5(e907); sIs11147 [rCes F54D8.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
NK2844 C. elegans cox-6A(qy173[cox-6A::mNG]) III. Show Description
mNeonGreen tag inserted into C-terminus of endogenous cox-6A locus. Insertion verified by PCR. Left flanking sequence: 5' AAGGTATCCGACATGAACCGT 3' ; Right flanking sequence: 5' CCATTCAAGCTTTACAGGGTTC 3'. sgRNA: 5' TCAGCCTCGAATCCAACTCC 3'.