| MCJ624 |
C. elegans |
alg-1(xk5[3xFLAG::alg-1] cdb358[D740A]) X. Show Description
3xFLAG tag inserted at N-terminus of short isoform of endogenous alg-1 locus. cdb358 is an engineered D740A substitution in the short isoform of alg-1, mutating the DDH catalytic triad to ADH. Catalytically inactive allele of alg-1. sgRNA #1: GACATCACTCATCCACCAGC; sgRNA #2: GCTACCATAGGCACCACGAG. sgRNA #2 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816.
|
|