| BB244 |
C. elegans |
adr-1(uu49) I; adr-2(uu28) rde-4(uu53) III. Show Description
RNAi deficient. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.
|
|
| DH244 |
C. elegans |
zyg-9(b244) II. Show Description
Temperature sensitive. Egg lethal. Abnormal first cleavage. Strict maternal effect (m,m). Will grow at 20C.
|
|
| GB244 |
C. elegans |
unc-96(sf18) X. Show Description
Adults are Unc - reduced motility; characteristic birefrigent "needles" in body wall muscle cells by polarized light microscopy; contain accumulations of paramyosin and UNC-98. Phenotype (needles and accumulations of paramyosin) is suppressed by growth at 15C or by starvation.
|
|
| RB2440 |
C. elegans |
C01B12.3(ok3363) II. Show Description
C01B12.3 Homozygous. Outer Left Sequence: aaccatttccctcatttcca. Outer Right Sequence: tcatcatcctctcccaaagg. Inner Left Sequence: tcactcgatgttgcttcttctt. Inner Right Sequence: gagaagcacttcggcaactt. Inner Primer PCR Length: 1105. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2441 |
C. elegans |
uba-5(ok3364) I. Show Description
T03F1.1 Homozygous. Outer Left Sequence: tttaaaccgccttggaaatg. Outer Right Sequence: agtgtgatggaaggcgagag. Inner Left Sequence: gaaagaccaccctctggagtc. Inner Right Sequence: gctccgactcatttaccagc. Inner Primer PCR Length: 1112. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2442 |
C. elegans |
C08E3.13(ok3365) II. Show Description
C08E3.13 Homozygous. Outer Left Sequence: gtcgaaaagttgccgaagtt. Outer Right Sequence: tcttcaaattaccaaggccg. Inner Left Sequence: acagccctggtgcagaacta. Inner Right Sequence: ggaaatgcgaatcccaacta. Inner Primer PCR Length: 1267. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2443 |
C. elegans |
abf-3(ok3366) V. Show Description
F54B8.5 Homozygous. Outer Left Sequence: tgcgaaacattccacagaaa. Outer Right Sequence: agatggcagacacgaagaca. Inner Left Sequence: agtttccagaagtcatgccc. Inner Right Sequence: cacagagtacgcttgcaaaa. Inner Primer PCR Length: 1126. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2444 |
C. elegans |
Y47G6A.3(ok3367) I. Show Description
Y47G6A.3 Homozygous. Outer Left Sequence: tggtcaagaacgtgctgaag. Outer Right Sequence: cagatcggcaattcggtaat. Inner Left Sequence: atcaaaccgtaacgggacag. Inner Right Sequence: tcagcagttatccaactccaaa. Inner Primer PCR Length: 1196. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2445 |
C. elegans |
tmd-2(ok3368) V. Show Description
C08D8.2Homozygous. Outer Left Sequence: ttacagaggcaatgcacgag. Outer Right Sequence: aaccggggatatcatcacaa. Inner Left Sequence: ccgaattgtttcttgggatg. Inner Right Sequence: tacaatccgttgcgtcaaaa. Inner Primer PCR Length: 1182. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2446 |
C. elegans |
C49C8.5(ok3369) IV. Show Description
C49C8.5 Homozygous. Outer Left Sequence: ttttgtgcctacccgtatcc. Outer Right Sequence: tatggccaattttcagaccc. Inner Left Sequence: gccgttgtcatcatcgtaaa. Inner Right Sequence: ttttgttactgttccagggctt. Inner Primer PCR Length: 1200. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2447 |
C. elegans |
str-220(ok3374) IV. Show Description
C42D4.9 Homozygous. Outer Left Sequence: tgtaacacggcaggttcaaa. Outer Right Sequence: acattccgttttccatttgc. Inner Left Sequence: ttggcgccacttcttcttta. Inner Right Sequence:ccagactgtccaaaatccaga . Inner Primer PCR Length: 1146. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2448 |
C. elegans |
ZC84.3(ok3375) III. Show Description
ZC84.3 Homozygous. Outer Left Sequence: cttgggaaaccttgtcgtgt. Outer Right Sequence: caaacatttccctttttggc. Inner Left Sequence: caaagaaagacccgtttcca. Inner Right Sequence: tgcaaatatgttccaatcaataca. Inner Primer PCR Length: 1312. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2449 |
C. elegans |
Y58A7A.3(ok3376) V. Show Description
Y58A7A.3 Homozygous. Outer Left Sequence: gagtttgcccaagttgcatt. Outer Right Sequence: tttggaagttcggcataagg. Inner Left Sequence: ccggccatagaatttttcag. Inner Right Sequence: tggatcgaatcgaagcatct. Inner Primer PCR Length: 1240. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|