| CHS1125 |
C. elegans |
f52d10.4(yum1729) f56a12.2(yum1730) m04g7.3(yum1731) ah9.4(yum1732) f54e4.2(yum1733) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1144 |
C. elegans |
npr-40(yum1846) ah9.1(yum1845) ah9.4(yum1848) b0563.6(yum1844) c17h11.1(yum1847) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1175 |
C. elegans |
srg-46(yum2038) srg-47(yum2039) V; srg-48(yum2040) srg-50(yum2041) srg-51(yum2042) IV; srg-53(yum2043) V; y54g2a.38(yum2045) y54g2a.77(yum2044) IV; ah9.1(yum2046) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| VC4158 |
C. elegans |
AH9.1(gk5243) K09C4.10(gk5244) X. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5243 mutation is C->T, flanking sequences TTCAGTCCGACTGTTTTGTGATGGCTGTCT and CAGAACCAATTACGTTTGTCAATTTTCCGC. The gk5244 mutation is C->A, flanking sequences TGTCTGATCCTTTCTCAATAGTTCCATCCT and GCGCTTTTCAGCAATATGATTTTCAGATCC.
|
|
| MAH914 |
C. elegans |
sqst-1(syb764) IV. Show Description
Full CRISPR deletion of sqst-1 locus. Reference: Kumsta C, et al. Nat Commun. 2019 Dec 11;10(1):5648.
|
|
| MAH97 |
C. elegans |
rrf-1(pk1417) I; muIs109. Show Description
muIs109 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.
|
|
| MAH99 |
C. elegans |
rrf-1(pk1417) I; muIs84. Show Description
muIs84 [sod-3p::GFP + rol-6(su1006)]. Weak rollers. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.
|
|
