Search Strains

More Fields
Strain Species Genotype Add
VC2460 C. elegans Y54E5A.5(gk1159) I; acs-3(gk3030) V. Show Description
Y54E5A.5, T08B1.6. The allele gk1159 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TGAAGACGTTGAAGCAGGTG. External right primer: TGTTGACGATGACGGTGTTT. Internal left primer: GTGTTGTTGAAGCAGCTGGA. Internal right primer: GTGGAGACGAAGATCCCAAA. Internal WT amplicon: 2024 bp. Deletion size: 775 bp. Deletion left flank: GGGCTAAAAACGCAAAAACTGCAATTTCTA. Deletion right flank: AAAACAAACAATTTTTCAATATAATTTAAC. The allele gk3030 was identified by CGH but not confirmed by PCR. Left flanking probe: CAAAAGAATCAATCCACTAACAAATTGATTGGAATCGCTGGAATTCACTC. Right flanking probe: GCGGGTTTGACCTGACTACAGTACCACTTTATCATCAATCGAAATTGGAG. Left deleted probe: GGAATCGCTGGAATTCACTCGAGAAAATATATGCACACGATGCATGGAAT. Right deleted probe: GCGGGTTTGACCTGACTACAGTACCACTTTATCATCAATCGAAATTGGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
DM7223 C. elegans pha-1(e2123) III; raEx223. Show Description
raEx223 [T05G5.1p::Y54E5A.5(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.