Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CB4088 C. elegans him-5(e1490) V. Show Description
From CB1490, which is a double mutant of him-5 with ali-1. CB4088 has been outcrossed to remove ali-1.
PS9529 C. elegans him-5(e1490) V; nlp-49(sy1815) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-49 into parental strain CB4088. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTGCTTTTGGCTGTTTTCTGCATTGCTGCCTAT. Right flanking sequence: CCTGGGCTGATGGGgtatgttccaatattgaacc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTGCATTGCTGCCTATGCCT Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.