Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB1288 C. elegans C48C5.1(ok1387) X. Show Description
C48C5.1 Homozygous. Outer Left Sequence: ttgccttgcattcaattgtc. Outer Right Sequence: tgctgaatgagcttcttgga. Inner Left Sequence: agtcattcggaaagcgaaaa. Inner Right Sequence: agcagatgaagaaagccgaa. Inner Primer PCR Length: 2844. Estimated Deletion Size: about 1200 bp. Breakpoint data provided by Neline Kriek 10/2004: GATACAGGTTTTAAGAAAACACCACTTGAAAAACGCAGACAACGTAAGATTTAAAACAT GACTCGTTbreakpointAGTCTAGTGGTCTAGTGAACCAGTTTGCAATTTATGGTTTG AATATTTTAATTACTTTTAATAGTTTGTACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807