Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC4178 C. elegans W03G9.2(gk5265) I; C34F11.1(gk5266) II. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5265 mutation is G->A, flanking sequences GAAATGACCGCCGAACTGAAGAAGTTAAAG and TGATATATACAACAATGAACAATCACTAAT. The gk5266 mutation is C->T, flanking sequences TCAGGCTCATGGCGAGCTCTTCCAGTGGCA and AAGGCGGTTCCTCACATATTCGTATCTGGC.