Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB2451 C. elegans C34D1.1(ok3378) V. Show Description
C34D1.1 Homozygous. Outer Left Sequence: ctgtctgctgagcattgagc. Outer Right Sequence: gagacatgcacactagccga. Inner Left Sequence: gtctggcttgtcaccactga. Inner Right Sequence: gagagaagcaaaagggggag. Inner Primer PCR Length: 1136. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2299 C. elegans dmd-10(gk1125) V. Show Description
C34D1.1. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 384 bp. Deletion left flank: CTATTCAAGAGAAACTCTAGAGGATCGCTT. Deletion right flank: AGTTTAAGAAAAATAAAGTAAAAGAAACTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2315 C. elegans C34D1.1(gk1132) V. Show Description
C34D1.1. Identified by PCR, validated by CGH. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 265 bp. Deletion left flank: TACGCACCTTTTGTGTCCCTTCAGGCGTGA. Deletion right flank: AGAAAAATAAAGTAAAAGAAACTGGAAAAT. Insertion Sequence: ATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2341 C. elegans C34D1.1(gk1131) V. Show Description
C34D1.1. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 571 bp. Deletion left flank: AAAAAGGAAAACGGTGTTTTCTACTACCAC. Deletion right flank: GTGAGTGCTGGAGGAGGTTGTTTTTCGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2344 C. elegans C34D1.1(gk1133) B0462.4(gk3031) V. Show Description
C34D1.1, B0462.4. The allele gk1133 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 337 bp. Deletion left flank: TTTTTTTCAGATATTTAGGTTAGTCCACTT. Deletion right flank: GGGCACGCCCACTTTATACTATTTTGATGT. Insertion Sequence: TAT. The allele gk3031 was identified by CGH and not confirmed by PCR. Left flanking probe: TTATAAACAGAGACAAATTTAGACCAAAACTCTGTAGGAAAGTGAGTTTT. Right flanking probe: ACAGGAATATGAATTGAGTGATTGCTTGTGGTAGACTCTGTAGATGGTCT. Left deleted probe: AAGTGAGTTTTTCCGTGTGTTCTGTGGGATCAGGTGCTCCAAATCTTCCA. Right deleted probe: GCGCCAATGCTAATATTATACTTATATAAAAGCACTTAACAAGCTGAGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807