TJ1 |
cep-1(gk138) I. |
C. elegans |
F52B5.5. URL: http://www.celeganskoconsortium.omrf.org. |
TJ101 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ103 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ104 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ1047 |
unc-4(e120) emb-27(g48) II. |
C. elegans |
Unc. Temperature sensitive. Maintain at 15C. |
TJ1049 |
dpy-10(e128) emb-27(g48) II. |
C. elegans |
Temperature sensitive. Dpy. |
TJ105 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ1052 |
age-1(hx546) II. |
C. elegans |
Long life. Normal fertility. Not Temperature sensitive. Stress tolerant. |
TJ106 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ1060 |
spe-9(hc88) I; rrf-3(b26) II. |
C. elegans |
Temperature sensitive. Maintain at 15C. See also WBPaper00002184. |
TJ1061 |
spe-9(hc88) I; emb-27(g48) II. |
C. elegans |
Temperature sensitive. Maintain at 15C. See also WBPaper00002184. |
TJ1062 |
spe-9(hc88) I; rrf-3(b26) age-1(hx542) II. |
C. elegans |
Temperature sensitive. Maintain at 15C. See also WBPaper00002184. |
TJ107 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ108 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ109 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ110 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ112 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ113 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ115 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ117 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ119 |
Recombinant inbred Bristol/Bergerac hybrid with altered lifespan: 12.3 days. |
C. elegans |
Mean lifespan 12.3 days. Carries Ts of BergBO. Carries Daf+ of N2. Males fertile. One of the shortest lived strains. No fertility at 25C. |
TJ120 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ121 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ122 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ123 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ124 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ127 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ129 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ130 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ131 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ132 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ135 |
Recombinant inbred Bristol/Bergerac hybrid with altered lifespan: 20 days. |
C. elegans |
Life span typically abut 20 days. Ts+ allele of N2. Daf allele of BergBO. Not male fertile. |
TJ140 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ141 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ142 |
Recombinant inbred Bristol/Bergerac hybrid with altered lifespan: 25 days. |
C. elegans |
Life span typically about 25 days. Carries Ts+ locus of N2. Carries Daf locus of BergBO. Males fertile. |
TJ143 |
Recombinant inbred Bristol/Bergerac hybrid with altered lifespan: 33 days. |
C. elegans |
Typical life span about 33 days. Carries Ts+ locus of N2 and Daf locus of BergBO. Males fertile. |
TJ144 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ146 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ147 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ148 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ202 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ203 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ205 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ207 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ211 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ213 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ215 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ216 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ220 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ221 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ223 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ225 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ226 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ230 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ231 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ232 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ235 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ236 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ239 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ241 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ242 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ246 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ251 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ257 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ258 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
Blistered. |
TJ261 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ264 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ265 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ266 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ267 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ270 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ273 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ274 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ276 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ277 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ279 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ280 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ282 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ283 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ286 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ290 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ292 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
No fertility at 25C. |
TJ294 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ295 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ296 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ297 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ299 |
Recombinant inbred Bristol/Bergerac BO hybrid. |
C. elegans |
|
TJ3000 |
zSi3000. |
C. elegans |
zSi3000 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6. |
TJ3001 |
zSi3001. |
C. elegans |
zSi3001 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6. |
TJ3014 |
zIs3000 II. |
C. elegans |
zIs3000 [old-1(+) + rol-6(su1006)]. Rollers. Shows life extension and stress resistance. zIs3000 is prone to silencing. |
TJ356 |
zIs356 IV. |
C. elegans |
zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. Daf-c, Rol, Fluorescent DAF-16::GFP, Age, increased resistance to heat and UV. Grows and reproduces slowly. Maintain at 20C. Integrated by gamma irradiation of extrachromosomal (Ex daf-16::GFP) line. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. April 2005: Corrigendum: daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Joshua McElwee of University College London has brought to our attention that plasmid pGP30 described in Henderson and Johnson (Current Biology 11, 1975-1980, December 2001) contains a mutation. We have confirmed the mutation in our own traces from the original sequence. Using daf-16a2 cDNA as a reference sequence (genbank accession number AF020343), pGP30 contains an A to T transversion at AF020343 position 1747:(TTCCCGATCAGCCACTGATGG(a/t)ACTATGGATGTTGATGCATTGA). This mutation results in an GAT (asp) to GTT(val) change at position 484 of the translated AF020343 sequence. The DAF-16::GFP (green fluorescent protein) protein encoded by pGP30 rescues a daf-16 null phenotype and behaves similarly to other reported DAF-16 fusion constructs (Lee et al., 2001; Lin et al., 2001). Therefore, we do not feel it alters the conclusions of the paper. We regret any inconvenience this may have caused. Samuel T. Henderson* and Thomas E. Johnson². ²Correspondence: johnsont@colorado.edu. Lee, R. Y., Hench, J., and Ruvkun, G. (2001). Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 11, 1950-1957.Lin, K., Hsin, H., Libina, N., and Kenyon, C. (2001). Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet 28, 139-145. This strain cannot be used for any commercial purpose or for work on human subjects. |
TJ375 |
gpIs1. |
C. elegans |
gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. Insertion not mapped. |
TJ401 |
age-1(hx546) rrf-3(b26) II. |
C. elegans |
Temperature sensitive sperm defect, grow at 15C. Long life (1.7X N2 is typical). Low brood size (15% of N2 is typical). |
TJ412 |
age-1(hx542) rrf-3(b26) II. |
C. elegans |
Long life (1.7X greater than N2). Low brood size (10% of N2). Temperature sensitive sperm defect; grow at 15C. WT. |
TJ415 |
age-1(hx546) rrf-3(b26) unc-4(e120) II. |
C. elegans |
Long lived (1.4X CB120). Low brood size. Unc. Temperature sensitive sperm defect. Maintain at 15C. |
TJ550 |
spe-9(hc88) I; rrf-3(b26) II; gpIs1. |
C. elegans |
gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. Temperature sensitive. Maintain at 15C. |