Laboratory Information

NameTJ View on WormBase
Allele designationz
HeadJohnson, Tom
InstitutionUniversity of Colorado, Boulder, CO
Address Institute for Behavioral Genetics, Box 447 University of Colorado at Boulder FEDEX address: 1480 30th St, Boulder 80303 Boulder, CO 80309-0447

Website http://ibgwww.colorado.edu/tj-lab/
Gene classes age  ikke  itt  lagr  old  pdhk  ros  tram 

Strains contributed by this laboratory

Strain Genotype Species Description
TJ1 cep-1(gk138) I. C. elegans F52B5.5. URL: http://www.celeganskoconsortium.omrf.org.
TJ101 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ103 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ104 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ1047 unc-4(e120) emb-27(g48) II. C. elegans Unc. Temperature sensitive. Maintain at 15C.
TJ1049 dpy-10(e128) emb-27(g48) II. C. elegans Temperature sensitive. Dpy.
TJ105 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ1052 age-1(hx546) II. C. elegans Long life. Normal fertility. Not Temperature sensitive. Stress tolerant.
TJ106 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ1060 spe-9(hc88) I; rrf-3(b26) II. C. elegans Temperature sensitive. Maintain at 15C. See also WBPaper00002184.
TJ1061 spe-9(hc88) I; emb-27(g48) II. C. elegans Temperature sensitive. Maintain at 15C. See also WBPaper00002184.
TJ1062 spe-9(hc88) I; rrf-3(b26) age-1(hx542) II. C. elegans Temperature sensitive. Maintain at 15C. See also WBPaper00002184.
TJ107 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ108 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ109 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ110 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ112 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ113 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ115 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ117 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ119 Recombinant inbred Bristol/Bergerac hybrid with altered lifespan: 12.3 days. C. elegans Mean lifespan 12.3 days. Carries Ts of BergBO. Carries Daf+ of N2. Males fertile. One of the shortest lived strains. No fertility at 25C.
TJ120 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ121 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ122 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ123 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ124 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ127 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ129 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ130 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ131 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ132 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ135 Recombinant inbred Bristol/Bergerac hybrid with altered lifespan: 20 days. C. elegans Life span typically abut 20 days. Ts+ allele of N2. Daf allele of BergBO. Not male fertile.
TJ140 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ141 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ142 Recombinant inbred Bristol/Bergerac hybrid with altered lifespan: 25 days. C. elegans Life span typically about 25 days. Carries Ts+ locus of N2. Carries Daf locus of BergBO. Males fertile.
TJ143 Recombinant inbred Bristol/Bergerac hybrid with altered lifespan: 33 days. C. elegans Typical life span about 33 days. Carries Ts+ locus of N2 and Daf locus of BergBO. Males fertile.
TJ144 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ146 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ147 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ148 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ202 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ203 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ205 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ207 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ211 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ213 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ215 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ216 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ220 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ221 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ223 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ225 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ226 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ230 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ231 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ232 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ235 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ236 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ239 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ241 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ242 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ246 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ251 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ257 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ258 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans Blistered.
TJ261 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ264 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ265 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ266 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ267 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ270 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ273 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ274 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ276 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ277 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ279 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ280 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ282 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ283 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ286 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ290 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ292 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans No fertility at 25C.
TJ294 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ295 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ296 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ297 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ299 Recombinant inbred Bristol/Bergerac BO hybrid. C. elegans
TJ3000 zSi3000. C. elegans zSi3000 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.
TJ3001 zSi3001. C. elegans zSi3001 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.
TJ3014 zIs3000 II. C. elegans zIs3000 [old-1(+) + rol-6(su1006)]. Rollers. Shows life extension and stress resistance. zIs3000 is prone to silencing.
TJ356 zIs356 IV. C. elegans zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. Daf-c, Rol, Fluorescent DAF-16::GFP, Age, increased resistance to heat and UV. Grows and reproduces slowly. Maintain at 20C. Integrated by gamma irradiation of extrachromosomal (Ex daf-16::GFP) line. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. April 2005: Corrigendum: daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Joshua McElwee of University College London has brought to our attention that plasmid pGP30 described in Henderson and Johnson (Current Biology 11, 1975-1980, December 2001) contains a mutation. We have confirmed the mutation in our own traces from the original sequence. Using daf-16a2 cDNA as a reference sequence (genbank accession number AF020343), pGP30 contains an A to T transversion at AF020343 position 1747:(TTCCCGATCAGCCACTGATGG(a/t)ACTATGGATGTTGATGCATTGA). This mutation results in an GAT (asp) to GTT(val) change at position 484 of the translated AF020343 sequence. The DAF-16::GFP (green fluorescent protein) protein encoded by pGP30 rescues a daf-16 null phenotype and behaves similarly to other reported DAF-16 fusion constructs (Lee et al., 2001; Lin et al., 2001). Therefore, we do not feel it alters the conclusions of the paper. We regret any inconvenience this may have caused. Samuel T. Henderson* and Thomas E. Johnson². ²Correspondence: johnsont@colorado.edu. Lee, R. Y., Hench, J., and Ruvkun, G. (2001). Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 11, 1950-1957.Lin, K., Hsin, H., Libina, N., and Kenyon, C. (2001). Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet 28, 139-145. This strain cannot be used for any commercial purpose or for work on human subjects.
TJ375 gpIs1. C. elegans gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. Insertion not mapped.
TJ401 age-1(hx546) rrf-3(b26) II. C. elegans Temperature sensitive sperm defect, grow at 15C. Long life (1.7X N2 is typical). Low brood size (15% of N2 is typical).
TJ412 age-1(hx542) rrf-3(b26) II. C. elegans Long life (1.7X greater than N2). Low brood size (10% of N2). Temperature sensitive sperm defect; grow at 15C. WT.
TJ415 age-1(hx546) rrf-3(b26) unc-4(e120) II. C. elegans Long lived (1.4X CB120). Low brood size. Unc. Temperature sensitive sperm defect. Maintain at 15C.
TJ550 spe-9(hc88) I; rrf-3(b26) II; gpIs1. C. elegans gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. Temperature sensitive. Maintain at 15C.
This laboratory hasn't submitted any alleles to the CGC.