Laboratory Information
Name | SS View on WormBase |
---|---|
Allele designation | bn |
Head | Susan Strome |
Institution | University of California, Santa Cruz, CA |
Address | 1156 High Street Thimann Receiving Sinsheimer Labs 329 Santa Cruz 95064 United States |
Website | http://bio.research.ucsc.edu/people/strome/index.html |
Gene classes | deps dom mes pgl set |
Strains contributed by this laboratory
Strain | Genotype | Species | Description |
---|---|---|---|
SS104 | glp-4(bn2) I. | C. elegans | Temperature sensitive defect in germ-line proliferation during larval development. Defect can be reversed by shifting worms from restrictive (25C) to permissive temperature (16C). Germ-line proliferation defect at restrictive temperature may be due to arrest in mitotic prophase. This strain is very useful for producing large populations of worms that essentially lack a germ line. |
SS149 | mes-1(bn7) X. | C. elegans | Temperature-sensitive. Maintain at 15C. The embryos from homozygous mutant mothers display defects in the unequal cell divisions of P2 and P3, defects in partitioning of germ granules during these divisions, and defects in formation of the germ-line precursor cell P4. The embryos that lack P4 develop into sterile adults. These defects are incompletely expressed and sensitive to temperature. Homozygous mothers produce about 10% sterile progeny at 16C and 70% sterile progeny at 25C. The temperature-sensitive period is early in embryogenesis, from fertilization to about the 28-cell stage. See also WBPaper00002282. |
SS186 | mes-2(bn11) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozygotes are WT and segregate WT, DpyUnc and Uncs which give sterile progeny (maternal effect sterile: the progeny from mutant mothers are sterile). The mutation is a strict mel, fully penetrant, and fully expressed. Sterility is due to a failure in germ-cell proliferation. |
SS2 | pgl-1(ct131) him-3(e1147) IV. | C. elegans | Temperature sensitive sterility. The sterility has both a maternal and a non-maternal component. Can be maintained indefinitely at low temperatures (16-23 C), with 7-19% sterile offspring. When low-temperature-grown homozygotes are allowed to produce progeny at 25C, the percentage of sterile offspring is 75-85%; at 26C the percentage of sterile offspring is 100%. Throws males. |
SS222 | mes-3(bn21) I. | C. elegans | Strict maternal effect sterile at 25C. TSP during embryogenesis. The progeny of homozygous mothers, raised at the restrictive temperature, are sterile. Sterile worms have dramatic reduction in number of germ cells (10-100 fold less than WT). |
SS230 | unc-13(e51) I; him-5(e1490) V; nDp4 (I;V)/+. | C. elegans | Animals with the Duplication are WT. Animals which have lost the Duplication are Unc. Throws males. |
SS262 | mes-3(bn35) dpy-5(e61) I; sDp2 (I;f). | C. elegans | Animals with the Duplication have a WT phenotype. Animals which have lost the Duplication are Dpy and give sterile Dpy progeny. Strict maternal effect sterile. Sterile worms have a dramatic reduction in number of germs cells (10-100 fold less than WT). See also WBPaper00002343. |
SS268 | dpy-11(e224) mes-4(bn23) unc-76(e911) V/nT1 [unc-?(n754) let-?] (IV;V). | C. elegans | Heterozygotes are Unc (n754 is a dominant Unc and recessive lethal). Throws DpyUncs which give sterile progeny. The maternal effect sterility is 99% expressed, 100% strict, and is associated with 2% maternal effect embryonic lethality. |
SS360 | mes-6(bn66) dpy-20(e1282) IV/nT1 [unc-?(n754) let-?] (IV;V). | C. elegans | Heterozygotes are Unc (n754 is dominant Unc and recessive lethal). Hets throw Dpys which give only sterile progeny. The maternal effect sterility is 99% expressed, 100% strict, and is associated with 1% maternal effect embryonic lethality. |
SS579 | pgl-1(bn101) IV. | C. elegans | Temperature sensitive sterility. The sterility has both a maternal and a non-maternal component. Can be maintained indefinitely at low temperatures (16-23 C), with 7-19% sterile offspring. When low-temperature-grown homozygotes are allowed to produce progeny at 25C, the percentage of sterile offspring is 75-85%; at 26C the percentage of sterile offspring is 100%. |
SS580 | pgl-1(bn102) IV. | C. elegans | Temperature sensitive sterility. The sterility has both a maternal and a non-maternal component. Can be maintained indefinitely at low temperatures (16-23 C), with 7-19% sterile offspring. When low-temperature-grown homozygotes are allowed to produce progeny at 25C, the percentage of sterile offspring is 75-85%; at 26C the percentage of sterile offspring is 100%. |
SS608 | pgl-3(bn104) V. | C. elegans | Fertile at all temperatures. |
SS609 | pgl-3(bn104) dpy-11(e224) V. | C. elegans | Dpy. Fertile at all temperatures. |
SS615 | pgl-1(bn101) unc-24(e138) IV; pgl-3(bn104) dpy-11(e224) V. | C. elegans | Dpy Unc. Temperature sensitive. Maintain at 15C. Grows very slowly. |
SS617 | pgl-1(ct131) him-3(e1147) unc-24(e138) IV; pgl-3(bn104) dpy-11(e224) V. | C. elegans | Throws males. Dpy. Unc. Mostly sterile at all temperatures, but a small fraction are fertile at low temperatures. Maintain at 15C. |
SS618 | pgl-1(ct131) him-3(e1147) IV; pgl-3(bn104) V. | C. elegans | Throws males. Mostly sterile at all temperatures, but a small fraction are fertile at low temperatures. Maintain at 15C. |
SS727 | pgl-2(bn123) III. | C. elegans | Fertile at all temperatures. |
SS729 | pgl-2(bn123) III; pgl-1(ct131) him-3(e1147) IV. | C. elegans | Throws males. Maintain at 15C. Sterile at higher temperatures. |
SS730 | pgl-2(bn123) III; pgl-1(bn101) unc-24(e138) IV. | C. elegans | Unc. Maintain at 15C. Sterile at higher temperatures. |
SS731 | pgl-2(bn123) III; pgl-3(bn104) dpy-11(e224) V. | C. elegans | Dpy. Fertile at all temperatures. |
SS733 | pgl-2(bn123) III; pgl-1(bn101) unc-24(e138) IV; pgl-3(bn104) dpy-11(e224) V. | C. elegans | Dpy. Unc. Mostly sterile at all temperatures, but a small fraction are fertile at low temperatures. Maintain at 15C. |
SS746 | klp-19(bn126)/mT1 [dpy-10(e128)] III. | C. elegans | Heterozygotes are WT and segregate WT, Dpys (mT1 homozygotes) and L1 lethals (bn126 homozygotes). klp-19 deletion is 435 bases between TTCACAGTGTTCGTGGAGAA and GCAAGGAATCGCGCCGGCT. klp-19 deletion is lethal over hT2. |
SS749 | deps-1(bn121) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | C. elegans | Maintain by picking GFP+ worms. deps-1 mutants are temperature-sensitive maternal-effect sterile (>80% sterile at 24.5C). Grow these balanced worms at 25C to verify that GFP+ worms are fertile and GFP- worms (deps-1 M+Z-) produce sterile progeny (M-Z-). It is best to keep deps-1 balanced because deps-1 M-Z- animals tend to lay many dead eggs and fewer eggs than WT at lower temps (15-20C). |
temp_name232 | deps-1(bn124) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). | Replaced by DG3226 (bn124 homozygote) |
Alleles contributed by this laboratory
Allele | Type | DNA Change | Protein Change |
---|---|---|---|
bn2 | Allele | substitution | |
bn7 | Allele | ||
bn18 | Allele | substitution | |
bn124 | Allele | substitution | nonsense |
bn104 | Allele | deletion | |
bn67 | Allele | substitution | |
bn4 | Allele | ||
bn11 | Allele | substitution | nonsense |
bn21 | Allele | substitution | |
bn35 | Allele | deletion | |
bn23 | Allele | substitution | splice_site |
bn66 | Allele | substitution | |
bn101 | Allele | substitution | nonsense |
bn102 | Allele | substitution | nonsense |
bn127 | Allele | deletion | |
bn123 | Allele | deletion | |
bn126 | Allele | deletion | |
bn121 | Allele | deletion | frameshift |
bn115 | Allele | deletion | frameshift |