Laboratory Information

NameSS View on WormBase
Allele designationbn
HeadSusan Strome
InstitutionUniversity of California, Santa Cruz, CA
Address 1156 High Street
Thimann Receiving
Sinsheimer Labs 329
Santa Cruz 95064
United States
Website http://bio.research.ucsc.edu/people/strome/index.html
Gene classes deps  dom  mes  pgl  set 

Strains contributed by this laboratory

Strain Genotype Species Description
SS104 glp-4(bn2) I. C. elegans Temperature sensitive defect in germ-line proliferation during larval development. Defect can be reversed by shifting worms from restrictive (25C) to permissive temperature (16C). Germ-line proliferation defect at restrictive temperature may be due to arrest in mitotic prophase. This strain is very useful for producing large populations of worms that essentially lack a germ line.
SS149 mes-1(bn7) X. C. elegans Temperature-sensitive. Maintain at 15C. The embryos from homozygous mutant mothers display defects in the unequal cell divisions of P2 and P3, defects in partitioning of germ granules during these divisions, and defects in formation of the germ-line precursor cell P4. The embryos that lack P4 develop into sterile adults. These defects are incompletely expressed and sensitive to temperature. Homozygous mothers produce about 10% sterile progeny at 16C and 70% sterile progeny at 25C. The temperature-sensitive period is early in embryogenesis, from fertilization to about the 28-cell stage. See also WBPaper00002282.
SS186 mes-2(bn11) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUnc and Uncs which give sterile progeny (maternal effect sterile: the progeny from mutant mothers are sterile). The mutation is a strict mel, fully penetrant, and fully expressed. Sterility is due to a failure in germ-cell proliferation.
SS2 pgl-1(ct131) him-3(e1147) IV. C. elegans Temperature sensitive sterility. The sterility has both a maternal and a non-maternal component. Can be maintained indefinitely at low temperatures (16-23 C), with 7-19% sterile offspring. When low-temperature-grown homozygotes are allowed to produce progeny at 25C, the percentage of sterile offspring is 75-85%; at 26C the percentage of sterile offspring is 100%. Throws males.
SS222 mes-3(bn21) I. C. elegans Strict maternal effect sterile at 25C. TSP during embryogenesis. The progeny of homozygous mothers, raised at the restrictive temperature, are sterile. Sterile worms have dramatic reduction in number of germ cells (10-100 fold less than WT).
SS230 unc-13(e51) I; him-5(e1490) V; nDp4 (I;V)/+. C. elegans Animals with the Duplication are WT. Animals which have lost the Duplication are Unc. Throws males.
SS262 mes-3(bn35) dpy-5(e61) I; sDp2 (I;f). C. elegans Animals with the Duplication have a WT phenotype. Animals which have lost the Duplication are Dpy and give sterile Dpy progeny. Strict maternal effect sterile. Sterile worms have a dramatic reduction in number of germs cells (10-100 fold less than WT). See also WBPaper00002343.
SS268 dpy-11(e224) mes-4(bn23) unc-76(e911) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc (n754 is a dominant Unc and recessive lethal). Throws DpyUncs which give sterile progeny. The maternal effect sterility is 99% expressed, 100% strict, and is associated with 2% maternal effect embryonic lethality.
SS360 mes-6(bn66) dpy-20(e1282) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc (n754 is dominant Unc and recessive lethal). Hets throw Dpys which give only sterile progeny. The maternal effect sterility is 99% expressed, 100% strict, and is associated with 1% maternal effect embryonic lethality.
SS579 pgl-1(bn101) IV. C. elegans Temperature sensitive sterility. The sterility has both a maternal and a non-maternal component. Can be maintained indefinitely at low temperatures (16-23 C), with 7-19% sterile offspring. When low-temperature-grown homozygotes are allowed to produce progeny at 25C, the percentage of sterile offspring is 75-85%; at 26C the percentage of sterile offspring is 100%.
SS580 pgl-1(bn102) IV. C. elegans Temperature sensitive sterility. The sterility has both a maternal and a non-maternal component. Can be maintained indefinitely at low temperatures (16-23 C), with 7-19% sterile offspring. When low-temperature-grown homozygotes are allowed to produce progeny at 25C, the percentage of sterile offspring is 75-85%; at 26C the percentage of sterile offspring is 100%.
SS608 pgl-3(bn104) V. C. elegans Fertile at all temperatures.
SS609 pgl-3(bn104) dpy-11(e224) V. C. elegans Dpy. Fertile at all temperatures.
SS615 pgl-1(bn101) unc-24(e138) IV; pgl-3(bn104) dpy-11(e224) V. C. elegans Dpy Unc. Temperature sensitive. Maintain at 15C. Grows very slowly.
SS617 pgl-1(ct131) him-3(e1147) unc-24(e138) IV; pgl-3(bn104) dpy-11(e224) V. C. elegans Throws males. Dpy. Unc. Mostly sterile at all temperatures, but a small fraction are fertile at low temperatures. Maintain at 15C.
SS618 pgl-1(ct131) him-3(e1147) IV; pgl-3(bn104) V. C. elegans Throws males. Mostly sterile at all temperatures, but a small fraction are fertile at low temperatures. Maintain at 15C.
SS727 pgl-2(bn123) III. C. elegans Fertile at all temperatures.
SS729 pgl-2(bn123) III; pgl-1(ct131) him-3(e1147) IV. C. elegans Throws males. Maintain at 15C. Sterile at higher temperatures.
SS730 pgl-2(bn123) III; pgl-1(bn101) unc-24(e138) IV. C. elegans Unc. Maintain at 15C. Sterile at higher temperatures.
SS731 pgl-2(bn123) III; pgl-3(bn104) dpy-11(e224) V. C. elegans Dpy. Fertile at all temperatures.
SS733 pgl-2(bn123) III; pgl-1(bn101) unc-24(e138) IV; pgl-3(bn104) dpy-11(e224) V. C. elegans Dpy. Unc. Mostly sterile at all temperatures, but a small fraction are fertile at low temperatures. Maintain at 15C.
SS746 klp-19(bn126)/mT1 [dpy-10(e128)] III. C. elegans Heterozygotes are WT and segregate WT, Dpys (mT1 homozygotes) and L1 lethals (bn126 homozygotes). klp-19 deletion is 435 bases between TTCACAGTGTTCGTGGAGAA and GCAAGGAATCGCGCCGGCT. klp-19 deletion is lethal over hT2.
SS749 deps-1(bn121) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Maintain by picking GFP+ worms. deps-1 mutants are temperature-sensitive maternal-effect sterile (>80% sterile at 24.5C). Grow these balanced worms at 25C to verify that GFP+ worms are fertile and GFP- worms (deps-1 M+Z-) produce sterile progeny (M-Z-). It is best to keep deps-1 balanced because deps-1 M-Z- animals tend to lay many dead eggs and fewer eggs than WT at lower temps (15-20C).
temp_name232 deps-1(bn124) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Replaced by DG3226 (bn124 homozygote)

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
bn2 Allele substitution
bn7 Allele
bn18 Allele substitution
bn124 Allele substitution nonsense
bn104 Allele deletion
bn67 Allele substitution
bn4 Allele
bn11 Allele substitution nonsense
bn21 Allele substitution
bn35 Allele deletion
bn23 Allele substitution splice_site
bn66 Allele substitution
bn101 Allele substitution nonsense
bn102 Allele substitution nonsense
bn127 Allele deletion
bn123 Allele deletion
bn126 Allele deletion
bn121 Allele deletion frameshift
bn115 Allele deletion frameshift