Laboratory Information
| Name | SM View on WormBase |
|---|---|
| Allele designation | px |
| Head | Susan E Mango |
| Institution | University of Basel |
| Address | Mango Lab Biozentrum Room 14.054 Cambridge 405602138 Switzerland |
| Website | https://www.biozentrum.unibas.ch/research/researchgroups/group/unit/mango/ |
| Gene classes | htz tlf arle |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| SM1017 | tlf-1(ok389)/unc-55(e402) blmp-1(s71) I. | C. elegans | Heterozygotes are wild type and segregate wild type, Dpy Uncs, and arrested early larva (L1s). Pick WT to maintain. |
| SM1052 | zen-4(px47) dpy-20(e1282)/bli-6(sc16) unc-24(e138) | C. elegans | Heterozygotes are WT and segregate WT, Bli Uncs, and dead embryos and L1s (with Pun phenotype). |
| SM1366 | mxl-2(tm1516) III. | C. elegans | No observable phenotype. |
| SM1480 | mxl-2(tm1516) pha-1(e2123) III; him-8(e1489) IV. | C. elegans | Worms are viable at 15C and dead at 24C. |
| SM1508 | mxl-2(tm1516) III; bar-1(ga80) X. | C. elegans | Most defects are similar to bar-1(ga80) single mutant animals [bar-1(ga80) hermaphrodites are usually Egl and often have a protruding vulva (Pvl), although approx. 40% of animals appear WT on plates. Also slightly Unc. In bar-1(ga80) hermaphrodites any of the six vulval precursor cells (P3.p - P8.p) can sometimes fuse with hyp7 without dividing, and P5.p - P7.p can adopt the tertiary cell fate instead of the primary or secondary fates. In addition, the neuroblast QL and its progeny migrate towards the anterior instead of the posterior, and the cell P12 usually adopts the fate of P11. bar-1(ga80) do mate, but poorly. bar-1 encodes a beta-catenin molecule and the ga80 mutation is predicted to cause an early truncation of the protein.] Increased severity of ray 1 displacement. |
| SM1584 | mxl-2(tm1516) III; plx-1(nc37) IV; him-5(e1490) V; bar-1(ga80) X. | C. elegans | Hermaphrodites are sluggish and exhibit protruding vulva, ruptured vulva, or internally hatched progeny. Males move slower than WT and have disorganized tail rays. |
| SM1585 | plx-1(nc37) IV; him-5(e1490) V; bar-1(ga80) X. | C. elegans | Hermaphrodites are sluggish and exhibit protruding vulva, ruptured vulva, or internally hatched progeny. Males move slower than WT and have disorganized tail rays. |
| SM1586 | mxl-2(tm1516) III; plx-1(nc37) IV; him-5(e1490) V. | C. elegans | Hermaphrodites seem fine. Males have a high penetrance of anterior displacement of ray 1. |
| SM190 | smg-1(cc546) I; pha-4(zu225) V. | C. elegans | Dies at 15-20C with mostly dead embyros and a few dead larvae. Grows best at 24C. Survives at 25C, but worms look sick (often small and clear) and have very reduced brood sizes. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).] |
| SM481 | pxIs10. | C. elegans | pxIs10 [pha-4::GFP::CAAX + rol-6(su1006)]. Roller line that has GFP localized to the plasma membrane of the pharynx, gut and rectal cells in embryos and the somatic gonad during L2-L3 larval stage and beyond. Reference: Portereiko MF & Mango SE. Dev Biol. 2001 May 15;233(2):482-94. |
| SM942 | tbp-1(ok185)/qC1 [dpy-19(e1259) glp-1(q339)] III. | C. elegans | Heterozygotes are WT and segregate WT, Dpy(ts) Steriles and dead embryos/larvae. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| px47 | Allele | substitution |