Laboratory Information
| Name | PLG View on WormBase |
|---|---|
| Allele designation | ccp |
| Head | Pablo Lara Gonzalez |
| Institution | University of California Irvine |
| Address | 4103 McGaugh Hall Irvine 92697 United States |
| Gene classes |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| PLG1 | src-1(ccp1[src-1::gfp]) I; unc-119(ed3) III; ltIs37 IV. | C. elegans | ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted at 3' end of endogenous src-1 locus using CRISPR/Cas9 engineering. gRNA sequence: AGCACAATTTTTTAGGCACT |
This laboratory hasn't submitted any alleles to the CGC.