Laboratory Information

NameNFB View on WormBase
Allele designationvlc
HeadNuria Flames
InstitutionInstituto de Biomedicina de Valencia (IBV-CSIC), Valencia, Spain
Address Instituto Biomedicina de Valencia
C/Jaume Roig n.11
Valencia 46010
Gene classes

Strains contributed by this laboratory

Strain Genotype Species Description
AL132 icIs132. C. elegans icIs132 [unc-40::GFP]. Superficially wild-type. unc-40 translational reporter. Reference: Chan SS, et al. Cell. 1996 Oct 18;87(2):187-95.
GR1333 yzIs71 V. C. elegans yzIs71 [tph-1p::GFP + rol-6(su1006)] V. Rollers. tph-1 transcriptional reporter containing 3.1kb of tph-1 5’ regulatory sequence through the beginning of exon 4. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Sze JY, et al. Nature. 2000 Feb 3;403(6769):560-4.
MH1337 kuIs34 IV. C. elegans kuIs34 [sem-4::GFP + unc-119(+)] IV. Superficially wild-type. Partial translational fusion reporter containing approximately half of SEM-4 fused in-frame to GFP. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Grant K, et al. Dev Biol. 2000 Aug 15;224(2):496-506.
NFB1079 vlcEx588. C. elegans vlcEx588 [aak-2p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains aak-2 enhancer sequence (+748, +1527) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NFB1090 vlcEx599. C. elegans vlcEx599 [ast-1p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains ast-1 enhancer sequence (-2852, -1999) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NFB1139 vlcEx641. C. elegans vlcEx641 [F37A8.5p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains F37A8.5 enhancer sequence (-2442, -1705) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NFB1149 vlcEx651. C. elegans vlcEx651 [lgc-49p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains lgc-49 enhancer sequence (-2649, -1782) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NFB1151 vlcEx653. C. elegans vlcEx653 [pde-3p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains pde-3 enhancer sequence (-2539, -1599) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NFB1164 vlcEx666. C. elegans vlcEx666 [klp-7p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains klp-7 enhancer sequence (+1434, +2287) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NFB1171 vlcEx673. C. elegans vlcEx673 [unc-32p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains unc-32 enhancer sequence (-1009, -76) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NFB1181 vlcEx683. C. elegans vlcEx683 [mgl-2p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains mgl-2 enhancer sequence (-4183, -3367) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NFB1215 vlcEx709. C. elegans vlcEx709 [mec-10p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains mec-10 enhancer sequence (-2831, -1860) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NFB1218 vlcEx712. C. elegans vlcEx712 [npr-1p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains npr-1 enhancer sequence (-6888, -6130) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NFB1352 vlcEx800. C. elegans vlcEx800 [pan-1p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains pan-1 enhancer sequence (-1050, -148) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NFB1369 ast-1(vlc19[ast-1::GFP]) II. C. elegans vlc19[ast-1::GFP] II. Superficially wild-type. Endogenous ast-1 locus tagged with GFP using Cas9-triggered homologous recombination. GFP was inserted at the C-terminus using a 9 amino acid flexible linker present in the plasmids (Dickinson et al., 2015). Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NFB1445 rrf-3(pk1426) II; lite-1(ce314) X; vlcEx1292. C. elegans vlcEx1292 [srh-142p::mCherry::SL2::GCaMP3 + unc-122p::RFP]. Maintain at or below 20C; sterile at 25C. ADF-specific expression of GCaMP3. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
NFB1692 hlh-3(vlc28[hlh-3::mNeonGreen]) II. C. elegans vlc28[hlh-3::mNeonGreen] II. Superficially wild-type. Endogenous hlh-3 locus tagged with mNeonGreen using Cas9-triggered homologous recombination. mNeonGreen was inserted at the C-terminus using a 9 amino acid flexible linker present in the plasmids (Dickinson et al., 2015). Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NFB1719 mod-5(vlc47[mod-5::T2A::mNeonGreen]) I. C. elegans mNeonGreen tag inserted into endogenous mod-5 locus. Upstream flanking sequence: AAATTATCGATAGTTCTCTTTTAGATCCAATcCAcACtCTcACaCCAGTT. Downstream flanking sequence: TAGATAATTCTTGGTGTACTGTTGGAAGTCAACGATCGATAGCCGTGCAC. Guide sequence: ACTGGAGTAAGTGTATGAAT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
NFB1720 tph-1(vlc46[tph-1::T2A::mNeonGreen]) II. C. elegans mNeonGreen tag inserted into endogenous tph-1 locus. Upstream flanking sequence: CTCTCCGCTCAGACATCAACCTGCTCGCCGGAGCTCTCCACTACATCCTG. Downstream flanking sequence: TAGTTTGAGTTTCCGTGTTTTTTATTTTTTTTATTTGGTTTCTGCTTTCT. Guide sequence: GTAGTTTGAGTTTCCGTGTT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
NFB1722 lag-1(vlc30[lag-1::T2A::mNG]) IV. C. elegans mNeonGreen tag inserted into endogenous lag-1 locus. Upstream flanking sequence: CCTACAAATCATTGGAACGACATGGACCGTGCAGAATTGTGTCCAATTAC. Downstream flanking sequence: TAGATTGGTCTCTCGCGGGATTACTGTATCTTTATATTGTCTCCTAATTT. Guide sequence: ATTACTAGATTCCACTCTCG. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
NFB1895 vlcEx1091. C. elegans vlcEx1091 [snt-1p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains snt-1 enhancer sequence (+993, +2170) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NFB1897 vlcEx1092. C. elegans vlcEx1092 [sprr-1p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains sprr-1 enhancer sequence (-2810, -1905) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NFB1899 vlcEx1093. C. elegans vlcEx1093 [sem-4p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains sem-4 enhancer sequence (+3376, +4551) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NFB1901 vlcEx1094. C. elegans vlcEx1094 [C53B4.4p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains C53B4.4 enhancer sequence (-1590, -338) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NFB1925 vlcIs10 X. C. elegans vlcIs10 [srh-142::mCherry + elt-2::GFP] X. ADF-specific reporter. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
NFB2468 zdIs13 IV; vlcEx1288. C. elegans zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1A(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1A. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
NFB2471 zdIs13 IV; vlcEx1290. C. elegans zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1D(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1D. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
NFB509 zdIs13 IV; vlcEx284. C. elegans zdIs13 [tph-1p::GFP] IV. vlcEx284 [hsp-16.2p::hlh-3 + ttx-3::mCherry + rol-6(su10006)]. Rollers. Extrachromosomal array containing the heat shock responsive hsp-16.2 promoter for time controlled expression of hlh-3 transcription factor cDNA. Transcriptional tph-1 GFP reporter labels the serotonergic system. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NFB608 vlcEx324. C. elegans vlcEx324 [egl-46p::NLS::DsRed + ttx-3p::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Transcriptional reporter for egl-46 contains NLS::DsRed fused to 4477 bp intergenic DNA. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
NFB922 vlcEx496. C. elegans vlcEx496 [lag-1::TY1::EGFP::3xFLAG + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Fosmid-based lag-1 reporter (clone WRM0625aC01) with TY1::EGFP::3xFLAG tag inserted in-frame at C-terminus of coding sequence by recombineering. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
RJP255 ynIs34 IV; him-5(e1490) V. C. elegans ynIs34 [flp-19p::GFP] IV. Him. Transcriptional flp-19 reporter. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Clark SG & Chiu C. Development. 2003 Aug;130(16):3781-94. Kim K & Li C. J Comp Neurol. 2004 Aug 2;475(4):540-50.
SK4013 zdIs13 IV. C. elegans zdIs13 [tph-1p::GFP] IV. Transcriptional tph-1 reporter. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Clark SG & Chiu C. Development. 2003 Aug;130(16):3781-94.
This laboratory hasn't submitted any alleles to the CGC.