Caenorhabditis Genetics Center (CGC)

Laboratory Information

NameMAA View on WormBase
Allele designationama
HeadMaria Armakola
InstitutionFeinberg School of Medicine
Address

Gene classes

Strains contributed by this laboratory

Strain Genotype Species Description
MAA1 ari-2(ama1) IV. C. elegans ari-2(ama1) is a CRISPR-engineered null allele replacing nearly all of the coding sequence with an insertion of stop codons in every frame (TAGATAAATGA). CRISPR edit was performed with dpy-10 co-CRISPR (Arribere, Bell et al. 2014). crRNAs (5': 5'- AGACATGAGCTGCACGTCCG; 3': 5'- AGTCGAAGAGCTCGCATGGG). Single-stranded repair template contained an insertion of stop codons in every frame (TAGATAAATGA) and 35bp homology on both sites. Generated in N2 background. Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665.
MAA10 tppp-1(tm5231) I; baIs11 IV. C. elegans baIs11 [dat-1p::GFP + dat-1p::alpha-synuclein] IV. [NOTE: baIs11 was originally publised as baIn11 due to a typographical error that has persisted.] tm5231 is a 190 bp deletion + 1 bp insertion (14075/14076-A-14265/14266) within tppp-1. Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665.
MAA11 tppp-1(tm5231) I; baIs11 ari-2(ama1) IV. C. elegans baIs11 [dat-1p::GFP + dat-1p::alpha-synuclein] IV. [NOTE: baIs11 was originally publised as baIn11 due to a typographical error that has persisted.] tm5231 is a 190 bp deletion + 1 bp insertion (14075/14076-A-14265/14266) within tppp-1. Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665.
MAA12 tppp-1(tm4902) vtIs7 I. C. elegans vtIs7 [dat-1p::GFP]. tm4920 is a 321 bp deletion + 2 bp insertion (13890/13891-GA-14211/14212) within tppp-1. Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665.
MAA13 tppp-1(tm4902) I; baIs11 IV. C. elegans baIs11 [dat-1p::GFP + dat-1p::alpha-synuclein] IV. [NOTE: baIs11 was originally publised as baIn11 due to a typographical error that has persisted.] tm4920 is a 321 bp deletion + 2 bp insertion (13890/13891-GA-14211/14212) within tppp-1. Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665.
MAA14 tppp-1(tm4902) I; baIs11 ari-2(ama1) IV. C. elegans baIs11 [dat-1p::GFP + dat-1p::alpha-synuclein] IV. [NOTE: baIs11 was originally publised as baIn11 due to a typographical error that has persisted.] tm4920 is a 321 bp deletion + 2 bp insertion (13890/13891-GA-14211/14212) within tppp-1. Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665.
MAA15 vtIs7 I; cul-5(ok1706) V. C. elegans vtIs7 [dat-1p::GFP]. Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665.
MAA16 baIs11 IV; cul-5(ok1706) V. C. elegans baIs11 [dat-1p::GFP + dat-1p::alpha-synuclein] IV. [NOTE: baIs11 was originally publised as baIn11 due to a typographical error that has persisted.] Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665.
MAA17 baIs11 ari-2(ama1) IV; cul-5(ok1706) V. C. elegans baIs11 [dat-1p::GFP + dat-1p::alpha-synuclein] IV. [NOTE: baIs11 was originally publised as baIn11 due to a typographical error that has persisted.] Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665.
MAA2 vtIs7 I; ari-2(ama1) IV. C. elegans vtIs7 [dat-1p::GFP]. Generated by crossing parental strains BY250 and MAA1. Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665.
MAA3 baIs11 ari-2(ama1) IV. C. elegans baIs11 [dat-1p::GFP + dat-1p::alpha-synuclein] IV. Generated by crossing parental strains UA44 and MAA1. [NOTE: baIs11 was originally publised as baIn11 due to a typographical error that has persisted.] Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665.
MAA4 ari-2(ama2[H147A]) IV. C. elegans ari-2(ama2) is a CRISPR-engineered [H147A] substitution creating a catalytically inactive RING-1 domain. CRISPR edit was performed with dpy-10 co-CRISPR (Arribere, Bell et al. 2014). crRNA (5'- GAATTACCACATTTAACATG). ssODN contained the desired edit and 35bp homology arms on both sides. Generated in N2 background. Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665.
MAA5 vtIs7 I; ari-2(ama2[H147A]) IV. C. elegans vtIs7 [dat-1p::GFP]. Generated by crossing parental strains BY250 and MAA4. Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665.
MAA6 baIs11 ari-2(ama2[H147A]) IV. C. elegans baIs11 [dat-1p::GFP + dat-1p::alpha-synuclein] IV. Generated by crossing parental strains UA44 and MAA4. [NOTE: baIs11 was originally publised as baIn11 due to a typographical error that has persisted.] Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665.
MAA7 baIs11 IV; nre-1(hd20) lin-15B (hd126) X. C. elegans baIs11 [dat-1p::GFP + dat-1p::alpha-synuclein] IV. [NOTE: baIs11 was originally publised as baIn11 due to a typographical error that has persisted.] Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665.
MAA8 vtIs7 I; nre-1(hd20) lin-15B (hd126) X. C. elegans vtIs7 [dat-1p::GFP]. Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665.
MAA9 tppp-1(tm5231) vtIs7 I. C. elegans vtIs7 [dat-1p::GFP]. tm5231 is a 190 bp deletion + 1 bp insertion (14075/14076-A-14265/14266) within tppp-1. Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665.
This laboratory hasn't submitted any alleles to the CGC.