Laboratory Information

NameKD View on WormBase
Allele designationej
HeadScholey, Jonathan
InstitutionUniversity of California, Davis, CA
Address Department of Molecular and Cell Biology University of California at Davis Briggs Hall, 1 Shields Ave. Davis, CA 95616

Website http://www.mcb.ucdavis.edu/faculty-labs/scholey/
Gene classes

Strains contributed by this laboratory

Strain Genotype Species Description
VC1228 klp-11(tm324) IV. C. elegans 331 bp deletion. T608 Stop. Flanking sequences: aaaatgagaaaaggaacaactgaattggac taatttttaaacacaaaacttactattgtt. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
This laboratory hasn't submitted any alleles to the CGC.