Laboratory Information

NameJCM View on WormBase
Allele designationjcm
HeadMartinou, Jean-Claude
InstitutionUniversity of Geneva, Geneva, Switzerland
Address Department of Cell Biology Univiversity of Geneva Sciences III, Bd d'Yvoie 32 CH-1211 Geneva 4

Website http://www.unige.ch/sciences/biologie/bicel/Martinou/index.html
Gene classes

Strains contributed by this laboratory

Strain Genotype Species Description
JCM1 hyl-2(gnv1) X. C. elegans gnv1 was found in strain AT10. hyl-2(+):CATCAT: aagcgcagtgatttctggcaaatgcttgttcatcattttatcaccctcgcacttattgg tgtttca; hyl-2(gnv1): CAATAT: aagcgcagtgatttctggcaaatgcttgttcaatattttatcaccctcgcacttattgg tgtttca. Anoxia sensitive. Heat-shock (36 deg Celcius) sensitive.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
gnv1 Allele