Laboratory Information
| Name | JCM View on WormBase |
|---|---|
| Allele designation | jcm |
| Head | Martinou, Jean-Claude |
| Institution | University of Geneva, Geneva, Switzerland |
| Address | Department of Cell Biology
Univiversity of Geneva
Sciences III, Bd d'Yvoie 32
CH-1211 Geneva 4 |
| Website | http://www.unige.ch/sciences/biologie/bicel/Martinou/index.html |
| Gene classes |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| JCM1 | hyl-2(gnv1) X. | C. elegans | gnv1 was found in strain AT10. hyl-2(+):CATCAT: aagcgcagtgatttctggcaaatgcttgttcatcattttatcaccctcgcacttattgg tgtttca; hyl-2(gnv1): CAATAT: aagcgcagtgatttctggcaaatgcttgttcaatattttatcaccctcgcacttattgg tgtttca. Anoxia sensitive. Heat-shock (36 deg Celcius) sensitive. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| gnv1 | Allele |