Laboratory Information

NameDUD View on WormBase
Allele designationdud
HeadDenis Dupuy
InstitutionIECB (Bordeaux), Pessac, France
Address Inserm U1212
2 rue Robert Escarpit
Pessac 33607
France
Website http://www.iecb.u-bordeaux.fr/teams/DUPUY/Lab_Members.html
Gene classes

Strains contributed by this laboratory

Strain Genotype Species Description
EN5271 (kr5271) I. C. elegans Mos1 transposon insertion in LG I. Presence of Mos1 can be detected using oligos oJL115 (Mos1 5'gctcaattcgcgccaaactatg3') and oVR261 (Chr I 5'gaaatagagggcagttcaacg3'). Reference: Giordano-Santini R, et al., (2010) Nature Methods. Aug 22.
EN5273 (kr5273) X. C. elegans Mos1 transposon insertion in LG X. Presence of Mos1 can be detected using oligos oJL115 (Mos1 5'gctcaattcgcgccaaactatg3') and oVR266 (Chr X 5'gacaaagacgtgtagttgcg3'). Reference: Giordano-Santini R, et al., (2010) Nature Methods. Aug 22.
OP50-NeoR E. coli. Escherichia coli Bacteria. OP50 transformed with pETMCN-EK (derived from pET-28b: Ori colE1, KanR) Kan-resistant plasmid. Resistant to Kanamycin, Neomycin, G418. Reference: Giordano-Santini R, et al., (2010) Nature Methods. Aug 22. Biosafety Level: BSL-1.
This laboratory hasn't submitted any alleles to the CGC.