Laboratory Information
| Name | DUD View on WormBase |
|---|---|
| Allele designation | dud |
| Head | Denis Dupuy |
| Institution | IECB (Bordeaux), Pessac, France |
| Address | Inserm U1212 2 rue Robert Escarpit Pessac 33607 France |
| Website | http://www.iecb.u-bordeaux.fr/teams/DUPUY/Lab_Members.html |
| Gene classes |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| EN5271 | (kr5271) I. | C. elegans | Mos1 transposon insertion in LG I. Presence of Mos1 can be detected using oligos oJL115 (Mos1 5'gctcaattcgcgccaaactatg3') and oVR261 (Chr I 5'gaaatagagggcagttcaacg3'). Reference: Giordano-Santini R, et al., (2010) Nature Methods. Aug 22. |
| EN5273 | (kr5273) X. | C. elegans | Mos1 transposon insertion in LG X. Presence of Mos1 can be detected using oligos oJL115 (Mos1 5'gctcaattcgcgccaaactatg3') and oVR266 (Chr X 5'gacaaagacgtgtagttgcg3'). Reference: Giordano-Santini R, et al., (2010) Nature Methods. Aug 22. |
| OP50-NeoR | E. coli. | Escherichia coli | Bacteria. OP50 transformed with pETMCN-EK (derived from pET-28b: Ori colE1, KanR) Kan-resistant plasmid. Resistant to Kanamycin, Neomycin, G418. Reference: Giordano-Santini R, et al., (2010) Nature Methods. Aug 22. Biosafety Level: BSL-1. |
This laboratory hasn't submitted any alleles to the CGC.