Laboratory Information
| Name | CF View on WormBase |
|---|---|
| Allele designation | mu |
| Head | Cynthia J Kenyon |
| Institution | Calico Life Sciences LLC |
| Address | Calico Life Sciences LLC 1170 Veterans Blvd South San Francisco 94080 United States |
| Website | https://www.calicolabs.com/cynthia-kenyon/ |
| Gene classes | cchl cco cwn cyc dct ddl dod drr fard gpi hsf iftb int maoc pry qid ref ril sams sinh spy tcer wnt dxbp |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| CB1456 | lin-17(e1456) I. | C. elegans | |
| CB3531 | mab-5(e1239) III; him-5(e1490) V. | C. elegans | Males abnormal. |
| CB3924 | pal-1(e2091) III; him-5(e1490) V. | C. elegans | Males are missing most of the rays and additional alae extend into the tail. |
| CF1038 | daf-16(mu86) I. | C. elegans | Dauer defective. Short lived. |
| CF1045 | muIs49. | C. elegans | muIs49 [unc-22(+) egl-20::GFP]. Rescuing translational egl-20::GFP fusion. Not known to which LG muIs49 is attached. A few cells in the tail will light up with GFP. |
| CF1097 | ref-1(mu220) II. | C. elegans | P9.p and P10.p fail to fuse with hyp7 during L1 in hermaphrodites. Misshapen head (low penetrance) most visible in L1. Ectopic postdeirid generated by V6 (low penetrance). |
| CF1135 | egl-20(n585) IV; muEx68. | C. elegans | muEx68 [(pJW33) myo-2p::egl-20::GFP + (7PD10.46) unc-22 (antisense)]. Use nicotine or levamisole to pick twitchers. Reference: Whangbo J & Kenyon C, (1999) Mol Cell 4(5):851-8. |
| CF1137 | daf-16(mu86) I; daf-2(e1370) III; muIs61. | C. elegans | muIs61 [daf-16a::GFP + rol-6(su1006)]. Temperature-sensitive. Maintain at 15 C. Rollers. Reference: Lin K, Hsin H, Libina N, Kenyon C. Nat Genet. 2001 Jun;28(2):139-45. |
| CF1139 | daf-16(mu86) I; muIs61. | C. elegans | muIs61 [(pKL78) daf16::GFP + rol-6(su1006)]. muIs61 rescues daf-16(mu86). muIs61 is a gamma-induced insertion of muEx50. muIs61 insertion point has not been mapped. |
| CF1170 | egl-20(n585) IV; muEx79. | C. elegans | muEx79 [(pJW33) myo-2p::egl-20::GFP + (7PD10.46) unc-22 (antisense)]. Use nicotine or levamisole to pick twitchers. Reference: Whangbo J & Kenyon C, (1999) Mol Cell 4(5):851-8. |
| CF1192 | egl-27(n170) II; muIs35 V. | C. elegans | muIs35 [mec-7::GFP + lin-15(+)]. |
| CF12 | rol-6(e187) II; lin-22(n372) IV; him-5(e1490) V. | C. elegans | Rollers. lin-22 and him-5 mutations affect neuroblast formation from epidermal precursor cell V5. |
| CF1259 | mig-13(mu225) lin-15B&lin-15A(n765) X; muIs62. | C. elegans | muIs62 [mig-13p::mig-13::GFP + lin-15(+)]. |
| CF1295 | daf-16(mu86) I; daf-2(e1370) III; muEx108. | C. elegans | muEx108 [(pKL99-2) daf-16::GFP/daf16bKO + rol-6(su1006)]. Grows okay at 20C. Rollers should form dauers at 25C. Pick Rollers to maintain. |
| CF1308 | daf-16(mu86) I; muEx116. | C. elegans | muEx116 [daf-16a::GFP(T54A S240A T242A S314A) + rol-6(su1006)]. Grows at all temperatures. Carries extrachromosomal array. Pick Rollers to maintain. |
| CF1330 | daf-16(mu86) I; muEx128. | C. elegans | muEx128 [(pKL79) daf-16a::GFP) + rol-6(su1006)]. Grows okay at 20C. Pick Rollers to maintain. |
| CF1371 | daf-16(mu86) I; muEx151. | C. elegans | muEx151 [(pKL106-8) daf-16aAM::GFP/bKO + rol-6(su1006)]. Grows okay at 20C. Pick Rollers to maintain. |
| CF1380 | daf-16(mu86) I; daf-2(e1370) III; muEx158. | C. elegans | muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which completely rescues dauer formation and partially restores longevity of daf-16; daf-2 double mutants. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45. |
| CF1395 | ceh-20(mu290) III; muIs164. | C. elegans | muIs164 [tax-4::GFP]. |
| CF1407 | daf-16(mu86) I; muIs71 X. | C. elegans | muIs71 [(pKL99) daf-16ap::GFP::daf-16a(bKO)) + rol-6(su1006)]. Grows okay at 20C. Spontaneous integrant. Rollers. |
| CF1442 | daf-16(mu86) I; daf-2(e1370) III; muEx169. | C. elegans | muEx169 [unc-119p::GFP::daf-16 + rol-6(su1006)]. Pick Rollers to maintain. May grow better at 15C. |
| CF1449 | daf-16(mu86) I; daf-2(e1370) III; muEx176. | C. elegans | muEx176 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Pick rollers to maintain -- Low transmission rate! Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45. |
| CF1514 | daf-16(mu86) I; daf-2(e1370) III; muEx211. | C. elegans | muEx211[pNL213(ges-1p::GFP::daf-16) + rol-6(su1006)]. Grows at 15C (probably also at 20C). Pick Rollers to maintain. |
| CF1515 | daf-16(mu86) I; daf-2(e1370) III; muEx212. | C. elegans | muEx212[pNL212(myo-3p::GFP::daf-16) + rol-6(su1006)]. Grows at 15C (probably also at 20C). Pick Rollers to maintain. |
| CF1553 | muIs84. | C. elegans | muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva. Many animals roll weakly or not at all, but still express GFP. Grows at all temperatures. |
| CF1580 | daf-2(e1370) III; muIs84. | C. elegans | muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva. Daf-C at 25C. Grows well at 20C. |
| CF1588 | daf-16(mu86) I; daf-2(e1370) III; muIs84. | C. elegans | muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Dim green expression in head, tail and around vulva. Daf-d. Can grow at 20C. |
| CF1595 | daf-16(mu86) I; daf-2(e1370) III; muEx227. | C. elegans | muEx227 [(pNL213) ges-1p::GFP::daf-16) + rol-6(su1006)]. Pick Rollers to maintain. |
| CF162 | mig-2(mu28) X. | C. elegans | mig-2 null mutation. Animals look grossly WT but Q descendants and other migratory neurons misplaced. |
| CF1632 | unc-62(mu232) muIs35 V. | C. elegans | muIs35 [mec-7::GFP + lin-15(+)]. Egl. GFP+. QR pax migration defect. |
| CF1641 | qid-6(mu252) III. | C. elegans | QL descendants migrate anteriorly. Bli. Unc. Weak Dpy. |
| CF1660 | daf-16(mu86) I; daf-2(e1370) III; muIs84; muEx211. | C. elegans | muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. muEx211 [ges-1p::daf-16::GFP + rol-6(su1006)]. Pick Rollers to maintain. Partial rescue of lifespan phenotype. Some animals show variable daf-16 expression in the intestine. Grows okay at 15C. [NOTE: muEx211 is quite unstable. Be sure to pick Rollers to avoid losing the array.] |
| CF1665 | muIs32 II; mig-15(mu327) X. | C. elegans | muIs32 [mec-7p::GFP + lin-15(+)]. QL descendants migrate anteriorly; defects in HSN migration, male tail formation and PLM axon outgrowth. Egl. Unc. Pvl. Weak Dpy. |
| CF1667 | mig-15(mu342) X. | C. elegans | QL descendants migrate anteriorly; defects in HSN migration, male tail formation and PLM axon outgrowth. Egl. Unc. Pvl. Weak Dpy. |
| CF1700 | daf-16(mu86) I; mes-1(bn7) X; muEx248. | C. elegans | muEx248 [(pNL209) daf-16::GFP::daf-16(cDNA) + podr-1::RFP]. Pick green (body) / red (head neurons) animals. Transmission efficiency ~50%. Can be grown at 20C with some sterility (30-50%). The higher the temperture, the greater the sterility. |
| CF1724 | daf-16(mu86) I; daf-2(e1370) III; muIs105. | C. elegans | muIs105 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Rollers; Rol phenotype is not always evident). Integrated line derived from CF1449. Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45. |
| CF1756 | ptp-3(mu245) muIs32 II. | C. elegans | muIs32 [mec-7p::GFP + lin-15(+)]. QL descendants migrate anteriorly. |
| CF1806 | ceh-20(mu290) III; muEx261. | C. elegans | muEx261[ceh-20::GFP at C terminus + odr-1::RFP]. |
| CF1814 | rrf-3(pk1426) II; daf-2(e1370) III. | C. elegans | Daf-c at 25.5C; grow at 20C or less. Long lived. |
| CF1824 | muEx265. | C. elegans | muEx265 [hsf-1p::hsf-1(cDNA) + myo-3::GFP]. Pick GFP worms to maintain. |
| CF1827 | daf-16(mu86) I; daf-2(e1370) III; muEx268. | C. elegans | muEx268 [ges-1p::GFP::daf-16(cDNA) + odr-1::RFP]. daf-16 GFP expressed in intestine. Partial rescue of lifespan phenotype. Grows okay at 15C. Pick RFP to maintain. |
| CF1844 | rrf-3(b26) II; daf-2(mu150) III; fem-1(hc17) IV. | C. elegans | Long lifespan. Maintain at 15C. Worms develop slowly at 20C, and are sterile at 25C. Reference: Garigan D, et al. Genetics. 2002 Jul;161(3):1101-12. |
| CF1864 | daf-10(mu377) IV. | C. elegans | Temperature-sensitive allele of daf-10 exhibits dye filling (Dyf) phenotype at 25C and non-Dyf at 20C. |
| CF1874 | daf-16(mu86) I; muIs84. | C. elegans | muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva. |
| CF1880 | daf-16(mu86) I; glp-1(e2141) III. | C. elegans | Sterile at 25C; grow at 20C or less. glp-1(e2141) longevity suppressed by daf-16(mu86). |
| CF1903 | glp-1(e2144) III. | C. elegans | Temperature sensitive. Sterile at 25C. Maintain at 15C. [NOTE: CF1903 carries glp-1(e2144), not e2141 as previously described.] |
| CF1935 | daf-16(mu86) I; glp-1(e2141) III; muIs109. | C. elegans | muIs109 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less. |
| CF196 | muIs3 V. | C. elegans | muIs3 [mab-5::lacZ + rol-6(su1006)] V. Rollers. |
| CF1980 | rrf-3(pk1426) II; daf-2(e1368) III. | C. elegans | Daf-c at 25.5C; grow at 20C or less. Long lived. |
| CF2005 | daf-16(mu86) I; daf-2(e1370) III; muIs120. | C. elegans | muIs120 [ges-1p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Long-lived. Gamma irradiation-induced integration of muEx211. Rescues daf-16a1/c in the intestine (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100. |
| CF2018 | muEx304. | C. elegans | muEx304 [lys-7p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100. |
| CF2031 | muEx306. | C. elegans | muEx306 [tcer-1::GFP + odr-1::RFP]. Maintain by picking RFP+ animals. Reference: Gahzi A, et al. PLoS Genet. 2009 Sep;5(9):e1000639. |
| CF2037 | muEx311. | C. elegans | muEx311 [pep-2p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. pep-2 is an other name for pept-1. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100. |
| CF2038 | muEx312. | C. elegans | muEx312 [dod-17p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100. |
| CF2052 | kri-1(ok1251) I. | C. elegans | Reference: Berman JR, Kenyon C. Cell. 2006 Mar 10;124(5):1055-68. |
| CF2060 | daf-16(mu86) I; muEx158. | C. elegans | muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which rescues daf-16 mutants from defective dauer formation and also partially rescues longevity defect of daf-16; glp-1 double mutants. Reference: Berman JR, & Kenyon C. Cell. 2006 Mar 10;124(5):1055-68. |
| CF2061 | daf-16(mu86) I; glp-1(e2141) III; muEx158. | C. elegans | muEx158 [daf-16AM::GFP + sur-5p::GFP]. Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. |
| CF2065 | kri-1(ok1251) I; glp-1(e2141) III. | C. elegans | Temperature-sensitive. Sterile at 25C. [NOTE: can be grown at 20C, but 15C might be better for long-term propagation.] kri-1(ok1251) suppresses the longevity of glp-1(e2141) mutants. |
| CF2093 | daf-16(mu86) I; daf-2(e1370) III; muIs131. | C. elegans | muIs131 [unc-119p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Modestly long-lived. Gamma irradiation-induced integration of muEx184. Rescues daf-16a1/c in neurons (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100. |
| CF2102 | daf-16(mu86) I; daf-2(e1370) III; muIs126. | C. elegans | muIs126 [myo-3p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Gamma irradiation-induced integration of muEx215. Rescues daf-16a1/c in muscles (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100. |
| CF2124 | muIs139. | C. elegans | muIs139 [dod-11p::RFP::NLS + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100. |
| CF2135 | daf-16(mu86) kri-1(ok1251) I; glp-1(e2141) III; muIs109. | C. elegans | muIs109 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less. |
| CF2154 | tcer-1(tm1452) II; glp-1(e2141) III. | C. elegans | Temperature sensitive sterile at 25C. tcer-1(-) causes loss of germ cells and increases lifespan. Reference: Ghazi A, Henis-Korenbilt S, & Kenyon C (2009) PLoS Genet 5(9):e1000639. |
| CF2164 | muEx329. | C. elegans | muEx329 [jnk-1::GFP + myo-3p::RFP]. Pick RFP+ to maintain. |
| CF2167 | tcer-1(tm1452) II. | C. elegans | Temperature sensitive sterile at 25C. tcer-1(-) causes loss of germ cells and increases lifespan. Reference: Ghazi A, Henis-Korenbilt S, & Kenyon C (2009) PLoS Genet 5(9):e1000639. |
| CF2218 | ncl-1(e1942) III. | C. elegans | Abnormal large nucleoli in most cells. |
| CF2222 | muEx336. | C. elegans | muEx336 [mtl-1::RFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100. |
| CF2247 | daf-16(mu86) I; glp-1(e2141) III; muEx248. | C. elegans | muEx248 [daf-16::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less. Pick RFP+/GFP+ animals to maintain. |
| CF2248 | daf-16(mu86) I; glp-1(e2141) III; daf-12(rh61rh411) X; muEx158. | C. elegans | muEx158 [daf-16AM::GFP + sur-5p::GFP]. Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. |
| CF2263 | daf-16(mu86) I; glp-1(e2141) III; daf-9(rh50) X; muEx158. | C. elegans | muEx158 [daf-16AM::GFP + sur-5p::GFP]. Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. |
| CF2265 | daf-16(mu86) kri-1(ok1251) I; glp-1(e2141) III; muEx158. | C. elegans | muEx158 [daf-16AM::GFP + sur-5p::GFP]. Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. |
| CF2266 | muEx340. | C. elegans | muEx340 [ges-1p::RFP + ges-1p::ins-7]. Intestinal expression of ins-7 shortens lifespan. Pick RFP animals to maintain. |
| CF2278 | daf-16(mu86) I; glp-1(e2141) III; daf-12(rh61rh411) X; muEx248. | C. elegans | muEx248 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less. Pick RFP+/GFP+ animals to maintain. |
| CF2282 | muEx344. | C. elegans | muEx344 [kri-1p::GFP::kri-1a cDNA + odr-1::RFP]. Maintain by picking RFP+ animals. Reference: Berman JR and Kenyon C. Cell. 2006 Mar 10;124(5):1055-68. |
| CF2288 | daf-16(mu86) I; glp-1(e2141) III; daf-9(rh50) X; muEx248. | C. elegans | muEx248 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less. Pick RFP+/GFP+ animals to maintain. |
| CF2310 | kri-1(ok1251) I; glp-1(e2141) III; muEx353. | C. elegans | muEx353 [kri-1(cDNA, a-isoform)::GFP + odr-1p::RFP]. Pick RFP+ to maintain. Temperature sensitive. Sterile at 25C; maintain at 15-20C. Reference: Berman JR and Kenyon C. Cell. 2006 Mar 10;124(5):1055-68. |
| CF237 | muIs2 unc-31(e169) IV. | C. elegans | muIs2 [mab-5::lacZ + unc-31(+)]. non-Unc. |
| CF2570 | daf-16(mu86) I; daf-2(e1370) III; muIs142. | C. elegans | muIs142 [ges-1p::GFP::daf-16(cDNA) + odr-1p::RFP]. Maintain at 15-20C. Gamma irradiation-induced integration of muEx268. Rescues daf-16a1/c in the intestine (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100. |
| CF26 | lin-22(mu2) IV; him-5(e1490) V. | C. elegans | Alae-to-ray transformation similar to that of n372 animals. |
| CF263 | egl-20(mu39) IV. | C. elegans | QL migration defect. HSN migratin defect. |
| CF2630 | sIs10314. | C. elegans | sIs10314 [rCesC06B3.4::GFP + pCeh361]. Strain was generated by outcrossing to remove dpy-5 from BC12544. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100. |
| CF267 | muIs6 IV. | C. elegans | muIs6 [lin-39::lacZ + rol-6(su1006)] IV. lin-39 promoter driving lacZ. muIs6 was integrated by gamma irradiation. |
| CF2805 | dop-2(vs105) V; dop-4(ok1321) dop-1(vs100) dop-3(vs106) X | C. elegans | Quadruple mutant removing four different dopamine receptor genes. |
| CF2885 | aqp-1(tm2309) II. | C. elegans | Homozygous viable, but short-lived. Reference: Lee SJ, et al. Cell Metab. 2009 Nov;10(5):379-91. |
| CF2892 | sEx10466. | C. elegans | sEx10466 [nnt-1p::GFP + (pCeh361)dpy-5(+)]. Pick GFP+ animals to maintain. Derived by outcrossing BC10466 2x to wild-type to remove dpy-5(e907). Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100. |
| CF2893 | sEx11128. | C. elegans | sEx11128 [gpd-2p::GFP + (pCeh361)dpy-5(+)]. Pick GFP+ animals to maintain. Derived by outcrossing BC11128 2x to wild-type to remove dpy-5(e907). Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100. |
| CF2962 | muEx420. | C. elegans | muEx420 [hsp-12.6p::RFP(NLS) + odr-1p::RFP]. Pick RFP+ animals to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100. |
| CF301 | mab-5(e2088) III; unc-31(e169) IV; him-5(e1490) V; muIs9 X. | C. elegans | muIs9 [hs-mab-5 + C14G10]. Heat-shock inducible mab-5. C14G10 contains a WT copy of unc-31. muIs9 integrated by gamma irradiation. |
| CF31 | lin-22(mu5) IV; him-5(e1490) V. | C. elegans | Alae-to-ray transformation similar to that of n372 animals. |
| CF3166 | muEx473. | C. elegans | muEx473 [kin-19p::kin-19::tagRFP + tph-1p::GFP]. Pick RFP+ GFP+ animals to maintain. Low transmission rate. Translational fusion of KIN-19 displaying age-dependent aggregation. Reference: David DC, et al. PLoS Biol. 2010 Aug 10;8(8):e1000450. |
| CF32 | lin-1(e1026) IV; him-5(e1490) V. | C. elegans | Very slow growth. |
| CF3556 | agIs6. | C. elegans | agIs6 [dod-24p::GFP]. Derived by outcrossing AU68 3 times to the Kenyon lab N2 strain. Reference: Yamawaki TM, et al. PLoS Biol. 2010 Aug 31;8(8). pii: e1000468. |
| CF36 | lin-22(n372) unc-33(e204) IV. | C. elegans | Desorption |
| CF367 | mig-14(mu71) II. | C. elegans | QL descendants anterior, QR descendants slightly posterior to WT. HSN posterior (50%), BDU posterior (50%), DTCs make extra turns. Mild Egl. Male Mating: ME2. mig-14, mom-3, pvl-2, and let-553 are the same gene. |
| CF376 | bar-1(mu63) X. | C. elegans | Weak allele of bar-1. |
| CF391 | muIs13 V. | C. elegans | muIs13 [egl-5::lacZ + rol-6(su1006)]. Rollers. New stock received at CGC November 2001. |
| CF439 | lin-39(mu26) III; dpy-20(e1282) IV; him-5(e1490) V; muIs23. | C. elegans | muIs23 [hsp::lin-39 + (pMH86) dpy-20(+)]. Heat-shock inducible lin-39. muIs23 is a spontaneous integrant whose chromosomal location is unknown. [NOTE: This strain was previously described as carrying lin-39(n1760), but it is actually carrying the g to a substitution of mu26. Strain MT7255 has been confirmed to be carrying the a to t substitution of n1760.] |
| CF453 | muIs16 II; dpy-20(e1282) IV. | C. elegans | muIs16 [mab-5::GFP + dpy-20(+)]. non-Dpy. |
| CF4582 | muIs252 II; unc-119(ed3) III. | C. elegans | muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of wrmScarlet1-10 (under the control of the eft-3 promoter and unc-54 3'UTR). Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628 |
| CF4586 | muIs252 II; unc-119(ed3) III; vha-13(mu493[wrmScarlet11::vha-13]) V. | C. elegans | muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::vha-13 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628 |
| CF4587 | muIs253 II; unc-119(ed3) III. | C. elegans | muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). [NOTE: A low level of "leaky" GFP expression from sfGFP1-10 is detected at high magnifications.] Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628 |
| CF4588 | muIs253 muIs252 II; unc-119(ed3) III. | C. elegans | muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 and wrmScarlet1-10 (both under the control of the eft-3 promoter and the unc-54 3'UTR). [NOTE: A low level of "leaky" GFP expression from sfGFP1-10 is detected at high magnifications.] Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628 |
| CF4592 | muIs253 II; unc-119(ed3) III; his-3(mu496[his-3::sfGFP11]) V. | C. elegans | muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). GFP11 tag inserted into endogenous his-3 locus via CRISPR/Cas9 insertion into parental strain CF4587. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628 |
| CF4594 | muIs252 II; unc-119(ed3) III; his-3(mu497[his-3::wrmScarlet11]) V. | C. elegans | muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628 |
| CF4601 | muIs252 II; unc-119(ed3) III; fib-1(mu498[wrmScarlet11::fib-1]) V. | C. elegans | muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628 |
| CF4608 | muIs252 II; unc-119(ed3) III; his-3(mu500[his-3::wrmScarlet11(x3)]) V. | C. elegans | muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11(x3) generated via CRISPR/Cas9 insertion of three wrmScarlet11 tags into the endogenous his-3 locus in parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628 |
| CF4609 | muIs252 II; kin-19(mu485[linker::wrmScarlet11]) unc-119(ed3) III. | C. elegans | muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of wrmScarlet1-10 (under the control of the eft-3 promoter and unc-54 3'UTR). Split-wrmScarlet11 tag was introduced at the C-terminus of the endogenous kin-19 locus using CRISPR/Cas9 and ssODN template in parental strain CF4582. kin-19 crRNA: GGCAACAAAACGTCTTACTG(TGG). ssODN template: ACAGGGAGCTACCGTTCCATCAGCTGGAGTTCCAGCTGGAGTTGCACCAGGAGGAACTACTCCACAGGGAGGAGGATCCTACACCGTCGTCGAGCAATACGAGAAGTCCGTCGCCCGTCACTGCACCGGAGGATAAgacgttttgttgccgtcctgaggctttttaatccaaaaaagcccatgttaaatcatgtactatc. Reference: Samaddar M, et al. Elife. 2021 Apr 13:10:e62653. doi: 10.7554/eLife.62653. PMID: 33848238. |
| CF4610 | muIs257 I. | C. elegans | muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Muscle-specific expression of wrmScarlet1-10 (Under the control of the myo-3 promoter and unc-54 3'UTR). Generated using CRISPR/Cas9 in the SKI-LODGE strain WBM1126. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249 |
| CF4611 | muIs257 I; fib-1(mu498[wrmScarlet11::fib-1]) V. | C. elegans | muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4610. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628 |
| CF4614 | muIs252 II; tbb-2(muIs260[wrmScarlet11::tbb-2]) unc-119(ed3) III. | C. elegans | muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11 inserted at the N-terminus of the endogenous tbb-2 locus; detectable in all somatic tissues where wrmScarlet1-10 is present. Figure 3B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628. |
| CF4616 | muIs252 II; unc-119(ed3) III; vha-13(muIs264[wrmScarlet11(x2)::vha-13]) V. | C. elegans | muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Two tandem repeats of split-wrmScarlet11 inserted at the N-terminus of the endogenous VHA-13 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure 4A from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628. |
| CF4625 | muIs252 II; unc-119(ed3) III; tomm-20(muIs276[tomm-20::wrmScarlet11(MDELYK)]) V. | C. elegans | muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11(MDELYK) inserted at the C-terminus of the endogenous TOMM-20 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure S6B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628. |
| CF4639 | glh-1(sam140[glh-1::T2A::wrmScarlet(1-10)]) I; fib-1(mu498[wrmScarlet11::fib-1]) V. | C. elegans | fib-1(mu498[wrmScarlet11::fib-1]) generated via CRISPR/Cas9 insertion into parental strain DUP237; transgene contains a linker between wrmScarlet11 and fib-1. Endogenous fib-1 detectable in the germline. T2A::wrmScarlet(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates wrmScarlet(1-10) from GLH-1 post-translationally so that wrmScarlet(1-10) disperses throughout germ cell nuclei and cytoplasm. wrmScarlet(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249. Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628. |
| CF491 | pry-1(mu38) I; him-5(e1490) V. | C. elegans | Very sick, Muv, Scrawny. Extra rays in males in body. Ectopic expression of lin-39, mab-5, egl-5. Cold sensitive - grows better at 25C. |
| CF512 | rrf-3(b26) II; fem-1(hc17) IV. | C. elegans | Grow at 15C. Sterile at 25C. |
| CF579 | dpy-20(e1282) IV; him-5(e1490) V; muIs27. | C. elegans | muIs27 [mig-2::GFP + dpy-20(+)]. Him. non-Dpy. GFP is membrane enriched and expressed in many cells throughout development (see reference for details). Not known in which LG muIs27 is integrated. |
| CF65 | mab-5(e2088) III; lin-22(n372) IV; him-5(e1490) V. | C. elegans | mab-5 mutation affects ectodermal and mesodermal lineages. lin-22 and him-5 mutations affect neuroblast formation from the epidermal precursor cell V5. |
| CF693 | unc-31(e169) IV; him-5(e1490) V; muIs28. | C. elegans | muIs28 [mig-2::GFP + unc-31(+)]. muIs28 is not mapped, but probably on LG II by process of elimination. |
| CF702 | muIs32 II. | C. elegans | muIs32 [mec-7p::GFP + lin-15(+)]. Superficially wild-type. Reference: Ch'ng, Q et al. (2003) Geneteics 164:1355-67. |
| CF716 | dpy-20(e1282) IV; mig-13(mu31) X; muIs37. | C. elegans | muIs37 [(pMS114) hsp::mig-13 + (pMH86) dpy-20(+)]. Inducible heat-shock promoter driven mig-13 rescues Q cell migration defects in mig-13(mu31) mutants. Reference: Sym, M., Robinson, N., and Kenyon, C. Cell. 1999 Jul 9;98(1):25-36. |
| CF726 | mig-13(mu225) X. | C. elegans | QR descendants fail to migrate anteriorly with 100% penetrance. BDUL/R fail to migrate anteriorly (incomplete penetrance). |
| CF80 | mab-3(mu15) II; him-5(e1490) V. | C. elegans | Abnormal V rays (male). |
| CF816 | him-5(e14??) V; ref-2(mu218) X. | C. elegans | In males, P7.p and P8.p fail to fuse with hyp7 at the end of L1. Dominant. him-5 allele is either e1467 or e1490. |
| CF891 | dpy-20(e1282) IV; muIs37. | C. elegans | muIs37 [(pMS114) hsp::mig-13 + (pMH86) dpy-20(+)]. Inducible heat-shock promoter driven mig-13 rescues Q cell migration defects in mig-13(mu31) mutants. Reference: Sym, M., Robinson, N., and Kenyon, C. Cell. 1999 Jul 9;98(1):25-36. |
| CF896 | dpy-20(e1282) IV; muIs42. | C. elegans | muIs42[mig-13::GFP + dpy-20(+)]. non-Dpy strain. GFP+ in ventral cord cells, pharyngeal-intestinal valve cells. |
| CF978 | unc-24(e138) IV; bar-1(mu349) X. | C. elegans | Unc. QL descendants in a mutant position (anterior of ALM). Okay to grow at 15 or 20C. |
| CF980 | egl-20(n585) IV; bar-1(mu349) X. | C. elegans | Egl. QL descendants in a mutant position (anterior of ALM). Okay to grow at 15 or 20C. |
| PHX1049 | vha-13(syb1049[GFP::vha-13]) V. | C. elegans | GFP inserted at N-terminus of endogenous vha-13 locus. GFP expression in the intestine and other tissues. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628. |
| PHX731 | vha-13(syb731[wrmScarlet::vha-13]) V. | C. elegans | wrmScarlet inserted at N-terminus of endogenous vha-13 locus. wrmScarlet expression in the intestine and other tissues. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| mu86 | Allele | deletion | |
| mu220 | Allele | substitution | |
| mu225 | Allele | deletion | |
| mu290 | Allele | substitution | |
| mu28 | Allele | substitution | nonsense |
| mu232 | Allele | substitution | |
| mu252 | Allele | ||
| mu327 | Allele | substitution | |
| mu342 | Allele | substitution | |
| mu245 | Allele | ||
| mu150 | Allele | substitution | |
| mu39 | Allele | substitution | |
| mu71 | Allele | ||
| mu63 | Allele | substitution | |
| mu38 | Allele | substitution | nonsense |
| mu31 | Allele | substitution | splice_site |
| mu15 | Allele | ||
| mu218 | Allele | substitution | |
| mu349 | Allele | substitution | |
| mu256 | Allele | insertion | frameshift |