Laboratory Information

NameCF View on WormBase
Allele designationmu
HeadCynthia J Kenyon
InstitutionCalico Life Sciences LLC
Address Calico Life Sciences LLC
1170 Veterans Blvd
South San Francisco 94080
United States
Website https://www.calicolabs.com/cynthia-kenyon/
Gene classes cchl  cco  cwn  cyc  dct  ddl  dod  drr  fard  gpi  hsf  iftb  int  maoc 
pry  qid  ref  ril  sams  sinh  spy  tcer  wnt  dxbp 

Strains contributed by this laboratory

Strain Genotype Species Description
CB1456 lin-17(e1456) I. C. elegans
CB3531 mab-5(e1239) III; him-5(e1490) V. C. elegans Males abnormal.
CB3924 pal-1(e2091) III; him-5(e1490) V. C. elegans Males are missing most of the rays and additional alae extend into the tail.
CF1038 daf-16(mu86) I. C. elegans Dauer defective. Short lived.
CF1045 muIs49. C. elegans muIs49 [unc-22(+) egl-20::GFP]. Rescuing translational egl-20::GFP fusion. Not known to which LG muIs49 is attached. A few cells in the tail will light up with GFP.
CF1097 ref-1(mu220) II. C. elegans P9.p and P10.p fail to fuse with hyp7 during L1 in hermaphrodites. Misshapen head (low penetrance) most visible in L1. Ectopic postdeirid generated by V6 (low penetrance).
CF1135 egl-20(n585) IV; muEx68. C. elegans muEx68 [(pJW33) myo-2p::egl-20::GFP + (7PD10.46) unc-22 (antisense)]. Use nicotine or levamisole to pick twitchers. Reference: Whangbo J & Kenyon C, (1999) Mol Cell 4(5):851-8.
CF1137 daf-16(mu86) I; daf-2(e1370) III; muIs61. C. elegans muIs61 [daf-16a::GFP + rol-6(su1006)]. Temperature-sensitive. Maintain at 15 C. Rollers. Reference: Lin K, Hsin H, Libina N, Kenyon C. Nat Genet. 2001 Jun;28(2):139-45.
CF1139 daf-16(mu86) I; muIs61. C. elegans muIs61 [(pKL78) daf16::GFP + rol-6(su1006)]. muIs61 rescues daf-16(mu86). muIs61 is a gamma-induced insertion of muEx50. muIs61 insertion point has not been mapped.
CF1170 egl-20(n585) IV; muEx79. C. elegans muEx79 [(pJW33) myo-2p::egl-20::GFP + (7PD10.46) unc-22 (antisense)]. Use nicotine or levamisole to pick twitchers. Reference: Whangbo J & Kenyon C, (1999) Mol Cell 4(5):851-8.
CF1192 egl-27(n170) II; muIs35 V. C. elegans muIs35 [mec-7::GFP + lin-15(+)].
CF12 rol-6(e187) II; lin-22(n372) IV; him-5(e1490) V. C. elegans Rollers. lin-22 and him-5 mutations affect neuroblast formation from epidermal precursor cell V5.
CF1259 mig-13(mu225) lin-15B&lin-15A(n765) X; muIs62. C. elegans muIs62 [mig-13p::mig-13::GFP + lin-15(+)].
CF1295 daf-16(mu86) I; daf-2(e1370) III; muEx108. C. elegans muEx108 [(pKL99-2) daf-16::GFP/daf16bKO + rol-6(su1006)]. Grows okay at 20C. Rollers should form dauers at 25C. Pick Rollers to maintain.
CF1308 daf-16(mu86) I; muEx116. C. elegans muEx116 [daf-16a::GFP(T54A S240A T242A S314A) + rol-6(su1006)]. Grows at all temperatures. Carries extrachromosomal array. Pick Rollers to maintain.
CF1330 daf-16(mu86) I; muEx128. C. elegans muEx128 [(pKL79) daf-16a::GFP) + rol-6(su1006)]. Grows okay at 20C. Pick Rollers to maintain.
CF1371 daf-16(mu86) I; muEx151. C. elegans muEx151 [(pKL106-8) daf-16aAM::GFP/bKO + rol-6(su1006)]. Grows okay at 20C. Pick Rollers to maintain.
CF1380 daf-16(mu86) I; daf-2(e1370) III; muEx158. C. elegans muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which completely rescues dauer formation and partially restores longevity of daf-16; daf-2 double mutants. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
CF1395 ceh-20(mu290) III; muIs164. C. elegans muIs164 [tax-4::GFP].
CF1407 daf-16(mu86) I; muIs71 X. C. elegans muIs71 [(pKL99) daf-16ap::GFP::daf-16a(bKO)) + rol-6(su1006)]. Grows okay at 20C. Spontaneous integrant. Rollers.
CF1442 daf-16(mu86) I; daf-2(e1370) III; muEx169. C. elegans muEx169 [unc-119p::GFP::daf-16 + rol-6(su1006)]. Pick Rollers to maintain. May grow better at 15C.
CF1449 daf-16(mu86) I; daf-2(e1370) III; muEx176. C. elegans muEx176 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Pick rollers to maintain -- Low transmission rate! Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
CF1514 daf-16(mu86) I; daf-2(e1370) III; muEx211. C. elegans muEx211[pNL213(ges-1p::GFP::daf-16) + rol-6(su1006)]. Grows at 15C (probably also at 20C). Pick Rollers to maintain.
CF1515 daf-16(mu86) I; daf-2(e1370) III; muEx212. C. elegans muEx212[pNL212(myo-3p::GFP::daf-16) + rol-6(su1006)]. Grows at 15C (probably also at 20C). Pick Rollers to maintain.
CF1553 muIs84. C. elegans muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva. Many animals roll weakly or not at all, but still express GFP. Grows at all temperatures.
CF1580 daf-2(e1370) III; muIs84. C. elegans muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva. Daf-C at 25C. Grows well at 20C.
CF1588 daf-16(mu86) I; daf-2(e1370) III; muIs84. C. elegans muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Dim green expression in head, tail and around vulva. Daf-d. Can grow at 20C.
CF1595 daf-16(mu86) I; daf-2(e1370) III; muEx227. C. elegans muEx227 [(pNL213) ges-1p::GFP::daf-16) + rol-6(su1006)]. Pick Rollers to maintain.
CF162 mig-2(mu28) X. C. elegans mig-2 null mutation. Animals look grossly WT but Q descendants and other migratory neurons misplaced.
CF1632 unc-62(mu232) muIs35 V. C. elegans muIs35 [mec-7::GFP + lin-15(+)]. Egl. GFP+. QR pax migration defect.
CF1641 qid-6(mu252) III. C. elegans QL descendants migrate anteriorly. Bli. Unc. Weak Dpy.
CF1660 daf-16(mu86) I; daf-2(e1370) III; muIs84; muEx211. C. elegans muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. muEx211 [ges-1p::daf-16::GFP + rol-6(su1006)]. Pick Rollers to maintain. Partial rescue of lifespan phenotype. Some animals show variable daf-16 expression in the intestine. Grows okay at 15C. [NOTE: muEx211 is quite unstable. Be sure to pick Rollers to avoid losing the array.]
CF1665 muIs32 II; mig-15(mu327) X. C. elegans muIs32 [mec-7p::GFP + lin-15(+)]. QL descendants migrate anteriorly; defects in HSN migration, male tail formation and PLM axon outgrowth. Egl. Unc. Pvl. Weak Dpy.
CF1667 mig-15(mu342) X. C. elegans QL descendants migrate anteriorly; defects in HSN migration, male tail formation and PLM axon outgrowth. Egl. Unc. Pvl. Weak Dpy.
CF1700 daf-16(mu86) I; mes-1(bn7) X; muEx248. C. elegans muEx248 [(pNL209) daf-16::GFP::daf-16(cDNA) + podr-1::RFP]. Pick green (body) / red (head neurons) animals. Transmission efficiency ~50%. Can be grown at 20C with some sterility (30-50%). The higher the temperture, the greater the sterility.
CF1724 daf-16(mu86) I; daf-2(e1370) III; muIs105. C. elegans muIs105 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Rollers; Rol phenotype is not always evident). Integrated line derived from CF1449. Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
CF1756 ptp-3(mu245) muIs32 II. C. elegans muIs32 [mec-7p::GFP + lin-15(+)]. QL descendants migrate anteriorly.
CF1806 ceh-20(mu290) III; muEx261. C. elegans muEx261[ceh-20::GFP at C terminus + odr-1::RFP].
CF1814 rrf-3(pk1426) II; daf-2(e1370) III. C. elegans Daf-c at 25.5C; grow at 20C or less. Long lived.
CF1824 muEx265. C. elegans muEx265 [hsf-1p::hsf-1(cDNA) + myo-3::GFP]. Pick GFP worms to maintain.
CF1827 daf-16(mu86) I; daf-2(e1370) III; muEx268. C. elegans muEx268 [ges-1p::GFP::daf-16(cDNA) + odr-1::RFP]. daf-16 GFP expressed in intestine. Partial rescue of lifespan phenotype. Grows okay at 15C. Pick RFP to maintain.
CF1844 rrf-3(b26) II; daf-2(mu150) III; fem-1(hc17) IV. C. elegans Long lifespan. Maintain at 15C. Worms develop slowly at 20C, and are sterile at 25C. Reference: Garigan D, et al. Genetics. 2002 Jul;161(3):1101-12.
CF1864 daf-10(mu377) IV. C. elegans Temperature-sensitive allele of daf-10 exhibits dye filling (Dyf) phenotype at 25C and non-Dyf at 20C.
CF1874 daf-16(mu86) I; muIs84. C. elegans muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva.
CF1880 daf-16(mu86) I; glp-1(e2141) III. C. elegans Sterile at 25C; grow at 20C or less. glp-1(e2141) longevity suppressed by daf-16(mu86).
CF1903 glp-1(e2144) III. C. elegans Temperature sensitive. Sterile at 25C. Maintain at 15C. [NOTE: CF1903 carries glp-1(e2144), not e2141 as previously described.]
CF1935 daf-16(mu86) I; glp-1(e2141) III; muIs109. C. elegans muIs109 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less.
CF196 muIs3 V. C. elegans muIs3 [mab-5::lacZ + rol-6(su1006)] V. Rollers.
CF1980 rrf-3(pk1426) II; daf-2(e1368) III. C. elegans Daf-c at 25.5C; grow at 20C or less. Long lived.
CF2005 daf-16(mu86) I; daf-2(e1370) III; muIs120. C. elegans muIs120 [ges-1p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Long-lived. Gamma irradiation-induced integration of muEx211. Rescues daf-16a1/c in the intestine (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.
CF2018 muEx304. C. elegans muEx304 [lys-7p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2031 muEx306. C. elegans muEx306 [tcer-1::GFP + odr-1::RFP]. Maintain by picking RFP+ animals. Reference: Gahzi A, et al. PLoS Genet. 2009 Sep;5(9):e1000639.
CF2037 muEx311. C. elegans muEx311 [pep-2p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. pep-2 is an other name for pept-1. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2038 muEx312. C. elegans muEx312 [dod-17p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2052 kri-1(ok1251) I. C. elegans Reference: Berman JR, Kenyon C. Cell. 2006 Mar 10;124(5):1055-68.
CF2060 daf-16(mu86) I; muEx158. C. elegans muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which rescues daf-16 mutants from defective dauer formation and also partially rescues longevity defect of daf-16; glp-1 double mutants. Reference: Berman JR, & Kenyon C. Cell. 2006 Mar 10;124(5):1055-68.
CF2061 daf-16(mu86) I; glp-1(e2141) III; muEx158. C. elegans muEx158 [daf-16AM::GFP + sur-5p::GFP]. Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less.
CF2065 kri-1(ok1251) I; glp-1(e2141) III. C. elegans Temperature-sensitive. Sterile at 25C. [NOTE: can be grown at 20C, but 15C might be better for long-term propagation.] kri-1(ok1251) suppresses the longevity of glp-1(e2141) mutants.
CF2093 daf-16(mu86) I; daf-2(e1370) III; muIs131. C. elegans muIs131 [unc-119p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Modestly long-lived. Gamma irradiation-induced integration of muEx184. Rescues daf-16a1/c in neurons (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.
CF2102 daf-16(mu86) I; daf-2(e1370) III; muIs126. C. elegans muIs126 [myo-3p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Gamma irradiation-induced integration of muEx215. Rescues daf-16a1/c in muscles (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.
CF2124 muIs139. C. elegans muIs139 [dod-11p::RFP::NLS + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2135 daf-16(mu86) kri-1(ok1251) I; glp-1(e2141) III; muIs109. C. elegans muIs109 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less.
CF2154 tcer-1(tm1452) II; glp-1(e2141) III. C. elegans Temperature sensitive sterile at 25C. tcer-1(-) causes loss of germ cells and increases lifespan. Reference: Ghazi A, Henis-Korenbilt S, & Kenyon C (2009) PLoS Genet 5(9):e1000639.
CF2164 muEx329. C. elegans muEx329 [jnk-1::GFP + myo-3p::RFP]. Pick RFP+ to maintain.
CF2167 tcer-1(tm1452) II. C. elegans Temperature sensitive sterile at 25C. tcer-1(-) causes loss of germ cells and increases lifespan. Reference: Ghazi A, Henis-Korenbilt S, & Kenyon C (2009) PLoS Genet 5(9):e1000639.
CF2218 ncl-1(e1942) III. C. elegans Abnormal large nucleoli in most cells.
CF2222 muEx336. C. elegans muEx336 [mtl-1::RFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2247 daf-16(mu86) I; glp-1(e2141) III; muEx248. C. elegans muEx248 [daf-16::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less. Pick RFP+/GFP+ animals to maintain.
CF2248 daf-16(mu86) I; glp-1(e2141) III; daf-12(rh61rh411) X; muEx158. C. elegans muEx158 [daf-16AM::GFP + sur-5p::GFP]. Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less.
CF2263 daf-16(mu86) I; glp-1(e2141) III; daf-9(rh50) X; muEx158. C. elegans muEx158 [daf-16AM::GFP + sur-5p::GFP]. Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less.
CF2265 daf-16(mu86) kri-1(ok1251) I; glp-1(e2141) III; muEx158. C. elegans muEx158 [daf-16AM::GFP + sur-5p::GFP]. Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less.
CF2266 muEx340. C. elegans muEx340 [ges-1p::RFP + ges-1p::ins-7]. Intestinal expression of ins-7 shortens lifespan. Pick RFP animals to maintain.
CF2278 daf-16(mu86) I; glp-1(e2141) III; daf-12(rh61rh411) X; muEx248. C. elegans muEx248 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less. Pick RFP+/GFP+ animals to maintain.
CF2282 muEx344. C. elegans muEx344 [kri-1p::GFP::kri-1a cDNA + odr-1::RFP]. Maintain by picking RFP+ animals. Reference: Berman JR and Kenyon C. Cell. 2006 Mar 10;124(5):1055-68.
CF2288 daf-16(mu86) I; glp-1(e2141) III; daf-9(rh50) X; muEx248. C. elegans muEx248 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less. Pick RFP+/GFP+ animals to maintain.
CF2310 kri-1(ok1251) I; glp-1(e2141) III; muEx353. C. elegans muEx353 [kri-1(cDNA, a-isoform)::GFP + odr-1p::RFP]. Pick RFP+ to maintain. Temperature sensitive. Sterile at 25C; maintain at 15-20C. Reference: Berman JR and Kenyon C. Cell. 2006 Mar 10;124(5):1055-68.
CF237 muIs2 unc-31(e169) IV. C. elegans muIs2 [mab-5::lacZ + unc-31(+)]. non-Unc.
CF2570 daf-16(mu86) I; daf-2(e1370) III; muIs142. C. elegans muIs142 [ges-1p::GFP::daf-16(cDNA) + odr-1p::RFP]. Maintain at 15-20C. Gamma irradiation-induced integration of muEx268. Rescues daf-16a1/c in the intestine (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.
CF26 lin-22(mu2) IV; him-5(e1490) V. C. elegans Alae-to-ray transformation similar to that of n372 animals.
CF263 egl-20(mu39) IV. C. elegans QL migration defect. HSN migratin defect.
CF2630 sIs10314. C. elegans sIs10314 [rCesC06B3.4::GFP + pCeh361]. Strain was generated by outcrossing to remove dpy-5 from BC12544. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF267 muIs6 IV. C. elegans muIs6 [lin-39::lacZ + rol-6(su1006)] IV. lin-39 promoter driving lacZ. muIs6 was integrated by gamma irradiation.
CF2805 dop-2(vs105) V; dop-4(ok1321) dop-1(vs100) dop-3(vs106) X C. elegans Quadruple mutant removing four different dopamine receptor genes.
CF2885 aqp-1(tm2309) II. C. elegans Homozygous viable, but short-lived. Reference: Lee SJ, et al. Cell Metab. 2009 Nov;10(5):379-91.
CF2892 sEx10466. C. elegans sEx10466 [nnt-1p::GFP + (pCeh361)dpy-5(+)]. Pick GFP+ animals to maintain. Derived by outcrossing BC10466 2x to wild-type to remove dpy-5(e907). Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2893 sEx11128. C. elegans sEx11128 [gpd-2p::GFP + (pCeh361)dpy-5(+)]. Pick GFP+ animals to maintain. Derived by outcrossing BC11128 2x to wild-type to remove dpy-5(e907). Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2962 muEx420. C. elegans muEx420 [hsp-12.6p::RFP(NLS) + odr-1p::RFP]. Pick RFP+ animals to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF301 mab-5(e2088) III; unc-31(e169) IV; him-5(e1490) V; muIs9 X. C. elegans muIs9 [hs-mab-5 + C14G10]. Heat-shock inducible mab-5. C14G10 contains a WT copy of unc-31. muIs9 integrated by gamma irradiation.
CF31 lin-22(mu5) IV; him-5(e1490) V. C. elegans Alae-to-ray transformation similar to that of n372 animals.
CF3166 muEx473. C. elegans muEx473 [kin-19p::kin-19::tagRFP + tph-1p::GFP]. Pick RFP+ GFP+ animals to maintain. Low transmission rate. Translational fusion of KIN-19 displaying age-dependent aggregation. Reference: David DC, et al. PLoS Biol. 2010 Aug 10;8(8):e1000450.
CF32 lin-1(e1026) IV; him-5(e1490) V. C. elegans Very slow growth.
CF3556 agIs6. C. elegans agIs6 [dod-24p::GFP]. Derived by outcrossing AU68 3 times to the Kenyon lab N2 strain. Reference: Yamawaki TM, et al. PLoS Biol. 2010 Aug 31;8(8). pii: e1000468.
CF36 lin-22(n372) unc-33(e204) IV. C. elegans Desorption
CF367 mig-14(mu71) II. C. elegans QL descendants anterior, QR descendants slightly posterior to WT. HSN posterior (50%), BDU posterior (50%), DTCs make extra turns. Mild Egl. Male Mating: ME2. mig-14, mom-3, pvl-2, and let-553 are the same gene.
CF376 bar-1(mu63) X. C. elegans Weak allele of bar-1.
CF391 muIs13 V. C. elegans muIs13 [egl-5::lacZ + rol-6(su1006)]. Rollers. New stock received at CGC November 2001.
CF439 lin-39(mu26) III; dpy-20(e1282) IV; him-5(e1490) V; muIs23. C. elegans muIs23 [hsp::lin-39 + (pMH86) dpy-20(+)]. Heat-shock inducible lin-39. muIs23 is a spontaneous integrant whose chromosomal location is unknown. [NOTE: This strain was previously described as carrying lin-39(n1760), but it is actually carrying the g to a substitution of mu26. Strain MT7255 has been confirmed to be carrying the a to t substitution of n1760.]
CF453 muIs16 II; dpy-20(e1282) IV. C. elegans muIs16 [mab-5::GFP + dpy-20(+)]. non-Dpy.
CF4582 muIs252 II; unc-119(ed3) III. C. elegans muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of wrmScarlet1-10 (under the control of the eft-3 promoter and unc-54 3'UTR). Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4586 muIs252 II; unc-119(ed3) III; vha-13(mu493[wrmScarlet11::vha-13]) V. C. elegans muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::vha-13 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4587 muIs253 II; unc-119(ed3) III. C. elegans muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). [NOTE: A low level of "leaky" GFP expression from sfGFP1-10 is detected at high magnifications.] Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4588 muIs253 muIs252 II; unc-119(ed3) III. C. elegans muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 and wrmScarlet1-10 (both under the control of the eft-3 promoter and the unc-54 3'UTR). [NOTE: A low level of "leaky" GFP expression from sfGFP1-10 is detected at high magnifications.] Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4592 muIs253 II; unc-119(ed3) III; his-3(mu496[his-3::sfGFP11]) V. C. elegans muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). GFP11 tag inserted into endogenous his-3 locus via CRISPR/Cas9 insertion into parental strain CF4587. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4594 muIs252 II; unc-119(ed3) III; his-3(mu497[his-3::wrmScarlet11]) V. C. elegans muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4601 muIs252 II; unc-119(ed3) III; fib-1(mu498[wrmScarlet11::fib-1]) V. C. elegans muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4608 muIs252 II; unc-119(ed3) III; his-3(mu500[his-3::wrmScarlet11(x3)]) V. C. elegans muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11(x3) generated via CRISPR/Cas9 insertion of three wrmScarlet11 tags into the endogenous his-3 locus in parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4609 muIs252 II; kin-19(mu485[linker::wrmScarlet11]) unc-119(ed3) III. C. elegans muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of wrmScarlet1-10 (under the control of the eft-3 promoter and unc-54 3'UTR). Split-wrmScarlet11 tag was introduced at the C-terminus of the endogenous kin-19 locus using CRISPR/Cas9 and ssODN template in parental strain CF4582. kin-19 crRNA: GGCAACAAAACGTCTTACTG(TGG). ssODN template: ACAGGGAGCTACCGTTCCATCAGCTGGAGTTCCAGCTGGAGTTGCACCAGGAGGAACTACTCCACAGGGAGGAGGATCCTACACCGTCGTCGAGCAATACGAGAAGTCCGTCGCCCGTCACTGCACCGGAGGATAAgacgttttgttgccgtcctgaggctttttaatccaaaaaagcccatgttaaatcatgtactatc. Reference: Samaddar M, et al. Elife. 2021 Apr 13:10:e62653. doi: 10.7554/eLife.62653. PMID: 33848238.
CF4610 muIs257 I. C. elegans muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Muscle-specific expression of wrmScarlet1-10 (Under the control of the myo-3 promoter and unc-54 3'UTR). Generated using CRISPR/Cas9 in the SKI-LODGE strain WBM1126. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249
CF4611 muIs257 I; fib-1(mu498[wrmScarlet11::fib-1]) V. C. elegans muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4610. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4614 muIs252 II; tbb-2(muIs260[wrmScarlet11::tbb-2]) unc-119(ed3) III. C. elegans muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11 inserted at the N-terminus of the endogenous tbb-2 locus; detectable in all somatic tissues where wrmScarlet1-10 is present. Figure 3B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
CF4616 muIs252 II; unc-119(ed3) III; vha-13(muIs264[wrmScarlet11(x2)::vha-13]) V. C. elegans muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Two tandem repeats of split-wrmScarlet11 inserted at the N-terminus of the endogenous VHA-13 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure 4A from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
CF4625 muIs252 II; unc-119(ed3) III; tomm-20(muIs276[tomm-20::wrmScarlet11(MDELYK)]) V. C. elegans muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11(MDELYK) inserted at the C-terminus of the endogenous TOMM-20 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure S6B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
CF4639 glh-1(sam140[glh-1::T2A::wrmScarlet(1-10)]) I; fib-1(mu498[wrmScarlet11::fib-1]) V. C. elegans fib-1(mu498[wrmScarlet11::fib-1]) generated via CRISPR/Cas9 insertion into parental strain DUP237; transgene contains a linker between wrmScarlet11 and fib-1. Endogenous fib-1 detectable in the germline. T2A::wrmScarlet(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates wrmScarlet(1-10) from GLH-1 post-translationally so that wrmScarlet(1-10) disperses throughout germ cell nuclei and cytoplasm. wrmScarlet(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249. Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
CF491 pry-1(mu38) I; him-5(e1490) V. C. elegans Very sick, Muv, Scrawny. Extra rays in males in body. Ectopic expression of lin-39, mab-5, egl-5. Cold sensitive - grows better at 25C.
CF512 rrf-3(b26) II; fem-1(hc17) IV. C. elegans Grow at 15C. Sterile at 25C.
CF579 dpy-20(e1282) IV; him-5(e1490) V; muIs27. C. elegans muIs27 [mig-2::GFP + dpy-20(+)]. Him. non-Dpy. GFP is membrane enriched and expressed in many cells throughout development (see reference for details). Not known in which LG muIs27 is integrated.
CF65 mab-5(e2088) III; lin-22(n372) IV; him-5(e1490) V. C. elegans mab-5 mutation affects ectodermal and mesodermal lineages. lin-22 and him-5 mutations affect neuroblast formation from the epidermal precursor cell V5.
CF693 unc-31(e169) IV; him-5(e1490) V; muIs28. C. elegans muIs28 [mig-2::GFP + unc-31(+)]. muIs28 is not mapped, but probably on LG II by process of elimination.
CF702 muIs32 II. C. elegans muIs32 [mec-7p::GFP + lin-15(+)]. Superficially wild-type. Reference: Ch'ng, Q et al. (2003) Geneteics 164:1355-67.
CF716 dpy-20(e1282) IV; mig-13(mu31) X; muIs37. C. elegans muIs37 [(pMS114) hsp::mig-13 + (pMH86) dpy-20(+)]. Inducible heat-shock promoter driven mig-13 rescues Q cell migration defects in mig-13(mu31) mutants. Reference: Sym, M., Robinson, N., and Kenyon, C. Cell. 1999 Jul 9;98(1):25-36.
CF726 mig-13(mu225) X. C. elegans QR descendants fail to migrate anteriorly with 100% penetrance. BDUL/R fail to migrate anteriorly (incomplete penetrance).
CF80 mab-3(mu15) II; him-5(e1490) V. C. elegans Abnormal V rays (male).
CF816 him-5(e14??) V; ref-2(mu218) X. C. elegans In males, P7.p and P8.p fail to fuse with hyp7 at the end of L1. Dominant. him-5 allele is either e1467 or e1490.
CF891 dpy-20(e1282) IV; muIs37. C. elegans muIs37 [(pMS114) hsp::mig-13 + (pMH86) dpy-20(+)]. Inducible heat-shock promoter driven mig-13 rescues Q cell migration defects in mig-13(mu31) mutants. Reference: Sym, M., Robinson, N., and Kenyon, C. Cell. 1999 Jul 9;98(1):25-36.
CF896 dpy-20(e1282) IV; muIs42. C. elegans muIs42[mig-13::GFP + dpy-20(+)]. non-Dpy strain. GFP+ in ventral cord cells, pharyngeal-intestinal valve cells.
CF978 unc-24(e138) IV; bar-1(mu349) X. C. elegans Unc. QL descendants in a mutant position (anterior of ALM). Okay to grow at 15 or 20C.
CF980 egl-20(n585) IV; bar-1(mu349) X. C. elegans Egl. QL descendants in a mutant position (anterior of ALM). Okay to grow at 15 or 20C.
PHX1049 vha-13(syb1049[GFP::vha-13]) V. C. elegans GFP inserted at N-terminus of endogenous vha-13 locus. GFP expression in the intestine and other tissues. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628.
PHX731 vha-13(syb731[wrmScarlet::vha-13]) V. C. elegans wrmScarlet inserted at N-terminus of endogenous vha-13 locus. wrmScarlet expression in the intestine and other tissues. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
mu86 Allele deletion
mu220 Allele substitution
mu225 Allele deletion
mu290 Allele substitution
mu28 Allele substitution nonsense
mu232 Allele substitution
mu252 Allele
mu327 Allele substitution
mu342 Allele substitution
mu245 Allele
mu150 Allele substitution
mu39 Allele substitution
mu71 Allele
mu63 Allele substitution
mu38 Allele substitution nonsense
mu31 Allele substitution splice_site
mu15 Allele
mu218 Allele substitution
mu349 Allele substitution
mu256 Allele insertion frameshift