Laboratory Information

NameBS View on WormBase
Allele designationoz
HeadTim Schedl
InstitutionWashington University School of Medicine, St. Louis MO, USA
Address Washington University School of Medicine
Department of Genetics, Campus Box 8232
4566 Scott Ave
St Lous 63110
United States
Website http://www.genetics.wustl.edu/tslab/
Gene classes cdtl  ddx  emo  eom  epn  ftr  gld  mett  mrps  oar  pole  rskd  rskn  rsks 
shv  syt  teg  toe  mpc  nemp 

Strains contributed by this laboratory

Strain Genotype Species Description
BS1175 cdk-4(gv3) X; ozEx76. C. elegans ozEx76 [cdk-4p::CDK-4::GFP + sur-5::DsRed)]. Maintain by picking DsRed+. ozEx76 is unstable; strain exhibits high levels of lethality and sterilty. ~10% of progeny are fertile. Reference: Fox PM, et al. Development. 2011 Jun;138(11):2223-34.
BS3156 unc-13(e51) gld-1(q485)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III. C. elegans Heterozygotes are wild-type and segregate WT heterozygotes, Unc (unc-13 gld-1 homozygotes), and Dpy (hT2 homozygotes; the bli-4 mutation is suppressed by dpy-18). XX Uncs have tumorous germline and are sterile; XO Uncs are cross fertile (though they don't mate due to the Unc mutation). q485 is the canonical allele of gld-1. It behaves like deletions of the locus in complementation tests and thus is genetically null. Molecularly, it is a deletion of 82 bases and fails to produce gld-1 RNA and protein.
BS3348 C07A4.1(ok144) X. C. elegans Primers used to detect the deletion: IQ789.E1: CACACATCGGTCTTCCACAC. IQ789.E2: AATGAAACACCGGAAACTCG. IQ789.I1: TGCAATTGTGTTGCAGGAAT. IQ789.I2: AAAAGAGTGGCTGGCTCGTA.
BS3383 pmk-3(ok169). C. elegans F42G8.4. No obvious phenotype. Follow by PCR. Predicted gene is a p38 related Map Kinase. Approx. 1.5 kb deletion by agarose gel (not sequenced so end points not known). Nested PCR primers for detecting F42G8.4: F42G8.4EL1 5' - TCGCCCTTTGTATGTCTTCC - 3'. F42G8.4ER1 5' - TTCTCCAGGGATTAACGGTG - 3'. F42G8.4IL1 5' - TTTTCACTGCGTCTCAATCG - 3'. F42G8.4IR1 5' - TTTCAAATTTGCAGGTGTGC - 3'.
BS3493 gld-3(ok308)/mIn1 [dpy-10(e128) mIs14] II. C. elegans Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok308 homozygotes (mostly sterile or Mel, but can be slowly propagated at 20C). Pick WT dim GFP and check for correct segregation of progeny to maintain.
BS509 ozDf2/dpy-21(e428) par-4(it33) V. C. elegans Heterozygotes are wild-type and segregate wild-type (heterozygotes), Dpys (dpy-21 par-4 homozygotes that lay dead eggs), and dead eggs (ozDf2 homozygotes). Maintain by picking wild-type.
BS518 ozDf1/sdc-3(y52y180) unc-76(e911) V. C. elegans Heterozygotes are slow growing with WT phenotype. Hets segregate more slow growing WT, embryonic lethals (ozDf1/ozDf1) and DpyUncs which are sick and have a maternal effect lethal (none of the offspring from the DpyUncs survive to reproduce). Maintain by picking WT.
BS5182 sec-61.G(oz1) sma-1(e30) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, dead eggs and Sma. sec-61.G sma-1 homozygotes grow up to be sterile adults, with endomitotic oocytes in the gonad arm. sec-61.G also known as emo-1.
BS5351 nos-2(ok230) nos-1(gv5)/mIn1 [dpy-10(e128) mIs14] II. C. elegans Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP nos-2 nos-1 homozygotes (segregate many dead embryos). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. Reference: Hansen D, et al. Development. 2004 Jan;131(1):93-104.
BS5431 prp-17(oz273) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile oz273 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
BS5435 prp-17(oz273) I/hT2 (I;III); glp-1(oz264) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans glp-1(oz264) is a gain-of-function allele. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile oz273; oz264 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
BS5633 ieSi64 II; lag-1(oz536oz537[lag-1::degron::3xHA]) IV. C. elegans ieSi64 [gld-1p::TIR1::mRuby::gld-1 3'UTR + Cbr-unc-119(+)] II. Essentially wild-type when maintained on NGM plates. All germline stem cells enter into meiosis when treated with Auxin (1mM). References: Chen J, et al. PLoS Genet. 2020 Mar 20;16(3):e1008650. PMID: 32196486. Chen J, et al. 2020 MicroPublication (https://doi.org/10.17912/micropub.biology.000310) .
BS585 unc-13(e51) ozDf5 I; nDp4 (I;V)/+. C. elegans Strain gives WT hermaphrodites and dead eggs.
BS7011 nemp-1(oz534)/sC1(s2023) [dpy-1(s2170) umnIs41] III. C. elegans Segregates WT RFP+ heterozygotes, viable non-RFP nemp-1(oz534) homozygotes, and RFP+ Dpy. Maintain by picking wild-type RFP+. About 10-20% of nemp-1(oz534) homozygotes are sterile.
BS7012 nemp-1(oz535)/sC1(s2023) [dpy-1(s2170) umnIs41] III. C. elegans Segregates WT RFP+ heterozygotes, viable non-RFP nemp-1(oz535) homozygotes, and RFP+ Dpy. Maintain by picking wild-type RFP+. About 10-20% of nemp-1(oz535) homozygotes are sterile.
BS913 unc-32(e189) glp-1(oz112)/unc-36(e251) glp-1(q175) III. C. elegans Heterozygotes are WT and segregate WT and Uncs (both Unc-32 and Unc-36). Tumorous germline phenotype in both hermaphrodites and males; semidominant and temperature sensitive. Even at permissive temperatures (15-20C) brood size is very small (10-20 viable progeny) because of the overproliferation of germ cells at the expense of oogenesis.
GG38 mett-10(g38) III. C. elegans Maternal effect temperature sensitive embryonic lethal. Leaky. Maintain at 15C. mett-10 was formerly known as let-42.
JH1463 nos-2(ok230) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUncs and dead eggs. The nos-2(ok230) allele is due to deletion of bases 30999 to 33076 of cosmid ZK1127 (GenBank accession U58758) and also deletes a portion of the him-14 gene (him-14 is in an intron of nos-2).
JK993 unc-51(e1189) fog-2(q71)/let-?(q265) V. C. elegans Heterozygotes are WT and segregate WT, Unc Females and Lethals. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
RC399 mett-10(g38) dpy-18(e364) III. C. elegans Dpy. Maternal effect temperature sensitive embryonic lethal - leaky. Maintain at 15C. mett-10 was formerly known as let-42.
UP749 ksr-2(dx27) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Segregates WT glowing hets, non-glowing steriles (germ cells in oogenesis arrested in pachytene), very rare homozygous hT2 glowing animals, and dead eggs. Vulval development in ksr-2 animals appears normal. The molecular lesion of dx27 is a 285 base deletion. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
oz1 Allele
oz201 Allele substitution
oz273 Allele deletion
oz264 Allele
oz40 Allele
oz112 Allele substitution
oz140 Allele substitution nonsense
oz113 Allele substitution nonsense