Laboratory Information
| Name | BS View on WormBase |
|---|---|
| Allele designation | oz |
| Head | Tim Schedl |
| Institution | Washington University School of Medicine, St. Louis MO, USA |
| Address | Washington University School of Medicine Department of Genetics, Campus Box 8232 4566 Scott Ave St Lous 63110 United States |
| Website | http://www.genetics.wustl.edu/tslab/ |
| Gene classes | cdtl ddx emo eom epn ftr gld mett mrps oar pole rskd rskn rsks shv syt teg toe mpc nemp |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| BS1175 | cdk-4(gv3) X; ozEx76. | C. elegans | ozEx76 [cdk-4p::CDK-4::GFP + sur-5::DsRed)]. Maintain by picking DsRed+. ozEx76 is unstable; strain exhibits high levels of lethality and sterilty. ~10% of progeny are fertile. Reference: Fox PM, et al. Development. 2011 Jun;138(11):2223-34. |
| BS3156 | unc-13(e51) gld-1(q485)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III. | C. elegans | Heterozygotes are wild-type and segregate WT heterozygotes, Unc (unc-13 gld-1 homozygotes), and Dpy (hT2 homozygotes; the bli-4 mutation is suppressed by dpy-18). XX Uncs have tumorous germline and are sterile; XO Uncs are cross fertile (though they don't mate due to the Unc mutation). q485 is the canonical allele of gld-1. It behaves like deletions of the locus in complementation tests and thus is genetically null. Molecularly, it is a deletion of 82 bases and fails to produce gld-1 RNA and protein. |
| BS3348 | C07A4.1(ok144) X. | C. elegans | Primers used to detect the deletion: IQ789.E1: CACACATCGGTCTTCCACAC. IQ789.E2: AATGAAACACCGGAAACTCG. IQ789.I1: TGCAATTGTGTTGCAGGAAT. IQ789.I2: AAAAGAGTGGCTGGCTCGTA. |
| BS3383 | pmk-3(ok169). | C. elegans | F42G8.4. No obvious phenotype. Follow by PCR. Predicted gene is a p38 related Map Kinase. Approx. 1.5 kb deletion by agarose gel (not sequenced so end points not known). Nested PCR primers for detecting F42G8.4: F42G8.4EL1 5' - TCGCCCTTTGTATGTCTTCC - 3'. F42G8.4ER1 5' - TTCTCCAGGGATTAACGGTG - 3'. F42G8.4IL1 5' - TTTTCACTGCGTCTCAATCG - 3'. F42G8.4IR1 5' - TTTCAAATTTGCAGGTGTGC - 3'. |
| BS3493 | gld-3(ok308)/mIn1 [dpy-10(e128) mIs14] II. | C. elegans | Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok308 homozygotes (mostly sterile or Mel, but can be slowly propagated at 20C). Pick WT dim GFP and check for correct segregation of progeny to maintain. |
| BS509 | ozDf2/dpy-21(e428) par-4(it33) V. | C. elegans | Heterozygotes are wild-type and segregate wild-type (heterozygotes), Dpys (dpy-21 par-4 homozygotes that lay dead eggs), and dead eggs (ozDf2 homozygotes). Maintain by picking wild-type. |
| BS518 | ozDf1/sdc-3(y52y180) unc-76(e911) V. | C. elegans | Heterozygotes are slow growing with WT phenotype. Hets segregate more slow growing WT, embryonic lethals (ozDf1/ozDf1) and DpyUncs which are sick and have a maternal effect lethal (none of the offspring from the DpyUncs survive to reproduce). Maintain by picking WT. |
| BS5182 | sec-61.G(oz1) sma-1(e30) V/nT1 [unc-?(n754) let-?] (IV;V). | C. elegans | Heterozygotes are Unc and segregate Unc, dead eggs and Sma. sec-61.G sma-1 homozygotes grow up to be sterile adults, with endomitotic oocytes in the gonad arm. sec-61.G also known as emo-1. |
| BS5351 | nos-2(ok230) nos-1(gv5)/mIn1 [dpy-10(e128) mIs14] II. | C. elegans | Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP nos-2 nos-1 homozygotes (segregate many dead embryos). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. Reference: Hansen D, et al. Development. 2004 Jan;131(1):93-104. |
| BS5431 | prp-17(oz273) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | C. elegans | Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile oz273 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. |
| BS5435 | prp-17(oz273) I/hT2 (I;III); glp-1(oz264) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | C. elegans | glp-1(oz264) is a gain-of-function allele. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile oz273; oz264 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. |
| BS5633 | ieSi64 II; lag-1(oz536oz537[lag-1::degron::3xHA]) IV. | C. elegans | ieSi64 [gld-1p::TIR1::mRuby::gld-1 3'UTR + Cbr-unc-119(+)] II. Essentially wild-type when maintained on NGM plates. All germline stem cells enter into meiosis when treated with Auxin (1mM). References: Chen J, et al. PLoS Genet. 2020 Mar 20;16(3):e1008650. PMID: 32196486. Chen J, et al. 2020 MicroPublication (https://doi.org/10.17912/micropub.biology.000310) . |
| BS585 | unc-13(e51) ozDf5 I; nDp4 (I;V)/+. | C. elegans | Strain gives WT hermaphrodites and dead eggs. |
| BS7011 | nemp-1(oz534)/sC1(s2023) [dpy-1(s2170) umnIs41] III. | C. elegans | Segregates WT RFP+ heterozygotes, viable non-RFP nemp-1(oz534) homozygotes, and RFP+ Dpy. Maintain by picking wild-type RFP+. About 10-20% of nemp-1(oz534) homozygotes are sterile. |
| BS7012 | nemp-1(oz535)/sC1(s2023) [dpy-1(s2170) umnIs41] III. | C. elegans | Segregates WT RFP+ heterozygotes, viable non-RFP nemp-1(oz535) homozygotes, and RFP+ Dpy. Maintain by picking wild-type RFP+. About 10-20% of nemp-1(oz535) homozygotes are sterile. |
| GG38 | mett-10(g38) III. | C. elegans | Maternal effect temperature sensitive embryonic lethal. Leaky. Maintain at 15C. mett-10 was formerly known as let-42. |
| JH1463 | nos-2(ok230) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozygotes are WT and segregate WT, DpyUncs and dead eggs. The nos-2(ok230) allele is due to deletion of bases 30999 to 33076 of cosmid ZK1127 (GenBank accession U58758) and also deletes a portion of the him-14 gene (him-14 is in an intron of nos-2). |
| JK993 | unc-51(e1189) fog-2(q71)/let-?(q265) V. | C. elegans | Heterozygotes are WT and segregate WT, Unc Females and Lethals. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| RC399 | mett-10(g38) dpy-18(e364) III. | C. elegans | Dpy. Maternal effect temperature sensitive embryonic lethal - leaky. Maintain at 15C. mett-10 was formerly known as let-42. |
| UP749 | ksr-2(dx27) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | C. elegans | qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Segregates WT glowing hets, non-glowing steriles (germ cells in oogenesis arrested in pachytene), very rare homozygous hT2 glowing animals, and dead eggs. Vulval development in ksr-2 animals appears normal. The molecular lesion of dx27 is a 285 base deletion. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| oz1 | Allele | ||
| oz201 | Allele | substitution | |
| oz273 | Allele | deletion | |
| oz264 | Allele | ||
| oz40 | Allele | ||
| oz112 | Allele | substitution | |
| oz140 | Allele | substitution | nonsense |
| oz113 | Allele | substitution | nonsense |