Laboratory Information
| Name | BS View on WormBase |
|---|---|
| Allele designation | oz |
| Head | Tim Schedl |
| Institution | Washington University School of Medicine, St. Louis, MO |
| Address | Washington University School of Medicine Department of Genetics, Campus Box 8232 4566 Scott Ave St Lous 63110 United States |
| Website | http://www.genetics.wustl.edu/tslab/ |
| Gene classes | cdtl ddx emo eom epn ftr gld mett mrps oar pole rskd rskn rsks shv syt teg toe mpc nemp |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| BS1175 | cdk-4(gv3) X; ozEx76. | C. elegans | ozEx76 [cdk-4p::CDK-4::GFP + sur-5::DsRed)]. Maintain by picking DsRed+. ozEx76 is unstable; strain exhibits high levels of lethality and sterilty. ~10% of progeny are fertile. Reference: Fox PM, et al. Development. 2011 Jun;138(11):2223-34. |
| BS3156 | unc-13(e51) gld-1(q485)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III. | C. elegans | Heterozygotes are wild-type and segregate WT heterozygotes, Unc (unc-13 gld-1 homozygotes), and Dpy (hT2 homozygotes; the bli-4 mutation is suppressed by dpy-18). XX Uncs have tumorous germline and are sterile; XO Uncs are cross fertile (though they don't mate due to the Unc mutation). q485 is the canonical allele of gld-1. It behaves like deletions of the locus in complementation tests and thus is genetically null. Molecularly, it is a deletion of 82 bases and fails to produce gld-1 RNA and protein. |
| BS3348 | C07A4.1(ok144) X. | C. elegans | Primers used to detect the deletion: IQ789.E1: CACACATCGGTCTTCCACAC. IQ789.E2: AATGAAACACCGGAAACTCG. IQ789.I1: TGCAATTGTGTTGCAGGAAT. IQ789.I2: AAAAGAGTGGCTGGCTCGTA. |
| BS3383 | pmk-3(ok169). | C. elegans | F42G8.4. No obvious phenotype. Follow by PCR. Predicted gene is a p38 related Map Kinase. Approx. 1.5 kb deletion by agarose gel (not sequenced so end points not known). Nested PCR primers for detecting F42G8.4: F42G8.4EL1 5' - TCGCCCTTTGTATGTCTTCC - 3'. F42G8.4ER1 5' - TTCTCCAGGGATTAACGGTG - 3'. F42G8.4IL1 5' - TTTTCACTGCGTCTCAATCG - 3'. F42G8.4IR1 5' - TTTCAAATTTGCAGGTGTGC - 3'. |
| BS3493 | gld-3(ok308)/mIn1 [dpy-10(e128) mIs14] II. | C. elegans | Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok308 homozygotes (mostly sterile or Mel, but can be slowly propagated at 20C). Pick WT dim GFP and check for correct segregation of progeny to maintain. |
| BS509 | ozDf2/dpy-21(e428) par-4(it33) V. | C. elegans | Heterozygotes are wild-type and segregate wild-type (heterozygotes), Dpys (dpy-21 par-4 homozygotes that lay dead eggs), and dead eggs (ozDf2 homozygotes). Maintain by picking wild-type. |
| BS518 | ozDf1/sdc-3(y52y180) unc-76(e911) V. | C. elegans | Heterozygotes are slow growing with WT phenotype. Hets segregate more slow growing WT, embryonic lethals (ozDf1/ozDf1) and DpyUncs which are sick and have a maternal effect lethal (none of the offspring from the DpyUncs survive to reproduce). Maintain by picking WT. |
| BS5182 | sec-61.G(oz1) sma-1(e30) V/nT1 [unc-?(n754) let-?] (IV;V). | C. elegans | Heterozygotes are Unc and segregate Unc, dead eggs and Sma. sec-61.G sma-1 homozygotes grow up to be sterile adults, with endomitotic oocytes in the gonad arm. sec-61.G also known as emo-1. |
| BS5351 | nos-2(ok230) nos-1(gv5)/mIn1 [dpy-10(e128) mIs14] II. | C. elegans | Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP nos-2 nos-1 homozygotes (segregate many dead embryos). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. Reference: Hansen D, et al. Development. 2004 Jan;131(1):93-104. |
| BS5431 | prp-17(oz273) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | C. elegans | Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile oz273 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. |
| BS5435 | prp-17(oz273) I/hT2 (I;III); glp-1(oz264) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | C. elegans | glp-1(oz264) is a gain-of-function allele. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile oz273; oz264 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. |
| BS5633 | ieSi64 II; lag-1(oz536oz537[lag-1::AID*::3xHA]) IV. | C. elegans | ieSi64 [gld-1p::TIR1::mRuby::gld-1 3'UTR + Cbr-unc-119(+)] II. Essentially wild-type when maintained on NGM plates. All germline stem cells enter into meiosis when treated with Auxin (1mM). References: Chen J, et al. PLoS Genet. 2020 Mar 20;16(3):e1008650. PMID: 32196486. Chen J, et al. 2020 MicroPublication (https://doi.org/10.17912/micropub.biology.000310) . |
| BS585 | unc-13(e51) ozDf5 I; nDp4 (I;V)/+. | C. elegans | Strain gives WT hermaphrodites and dead eggs. |
| BS608 | mett-10(oz36) III. | C. elegans | Temperature-sensitive. Maintain at 20C. 20C: essentially wild-type. 25C: slow growth, sickly, largely sterile. 15C: high frequency of late-onset germ line over-proliferation. Reference: Dorsett M, et al. Genetics. 2009 Sep;183(1):233-47. doi: 10.1534/genetics.109.105270. Epub 2009 Jul 13. PMID: 19596901. |
| BS7011 | nemp-1(oz534)/sC1(s2023) [dpy-1(s2170) umnIs41] III. | C. elegans | Segregates WT RFP+ heterozygotes, viable non-RFP nemp-1(oz534) homozygotes, and RFP+ Dpy. Maintain by picking wild-type RFP+. About 10-20% of nemp-1(oz534) homozygotes are sterile. |
| BS7012 | nemp-1(oz535)/sC1(s2023) [dpy-1(s2170) umnIs41] III. | C. elegans | Segregates WT RFP+ heterozygotes, viable non-RFP nemp-1(oz535) homozygotes, and RFP+ Dpy. Maintain by picking wild-type RFP+. About 10-20% of nemp-1(oz535) homozygotes are sterile. |
| GG38 | mett-10(g38) III. | C. elegans | Maternal effect temperature sensitive embryonic lethal. Leaky. Maintain at 15C. mett-10 was formerly known as let-42. |
| JH1463 | nos-2(ok230) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozygotes are WT and segregate WT, DpyUncs and dead eggs. The nos-2(ok230) allele is due to deletion of bases 30999 to 33076 of cosmid ZK1127 (GenBank accession U58758) and also deletes a portion of the him-14 gene (him-14 is in an intron of nos-2). |
| JK993 | unc-51(e1189) fog-2(q71)/let-?(q265) V. | C. elegans | Heterozygotes are WT and segregate WT, Unc Females and Lethals. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. |
| RC399 | mett-10(g38) dpy-18(e364) III. | C. elegans | Dpy. Maternal effect temperature sensitive embryonic lethal - leaky. Maintain at 15C. mett-10 was formerly known as let-42. |
| UP749 | ksr-2(dx27) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | C. elegans | qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Segregates WT glowing hets, non-glowing steriles (germ cells in oogenesis arrested in pachytene), very rare homozygous hT2 glowing animals, and dead eggs. Vulval development in ksr-2 animals appears normal. The molecular lesion of dx27 is a 285 base deletion. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| oz1 | Allele | ||
| oz201 | Allele | substitution | |
| oz273 | Allele | deletion | |
| oz264 | Allele | ||
| oz40 | Allele | ||
| oz112 | Allele | substitution | |
| oz140 | Allele | substitution | nonsense |
| oz113 | Allele | substitution | nonsense |