Laboratory Information
| Name | AX View on WormBase |
|---|---|
| Allele designation | db |
| Head | Mario G de Bono |
| Institution | Institute of Science and Technology Austria, Klosterneuburg, Austria |
| Address | IST Austria Am Campus 1 Maria Gugging Klosterneuburg 3400 Austria |
| Website | http://www2.mrc-lmb.cam.ac.uk/groups/debono/Index.html |
| Gene classes | lnr maco actl |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| AX1295 | gcy-35(ok769) I. | C. elegans | Supresses aggregation and bordering phenotypes of npr-1(null) animals. |
| AX1296 | gcy-36(db42) X. | C. elegans | Supresses aggregation and bordering phenotypes of npr-1(null) animals. |
| AX1297 | gcy-36(db66) X. | C. elegans | Supresses aggregation and bordering phenotypes of npr-1(null) animals. |
| AX1305 | gcy-34(ok1012) V; npr-1(ad609) X. | C. elegans | Does not supress aggregation and bordering phenotypes of npr-1(null) animals. |
| AX1410 | flp-18(db99) X. | C. elegans | Impaired chemotaxis and foraging behavior. Excess intestinal fat accumulation. Reduced oxygen consumption. Derived from NL4000. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385. |
| AX1789 | dbEx719. | C. elegans | dbEx719 [npr-5::mCherry + unc-122p::GFP]. Pick GFP+ to maintain. mCherry expression in a subset of amphid neurons (ADF, ASE, ASG, ASI, ASJ, ASK, AWA, AWB), in the inner labial neuron IL2, in the interneurons AIA and AUA, and in the phasmids (PHA, PHB). Expression was also seen in head, neck, and body wall muscles. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385. |
| AX1791 | npr-5(ok1583) V; dbEx720. | C. elegans | dbEx720 [npr-5::npr-5(cDNA) + unc-122p::GFP]. Pick GFP+ to maintain. Intestinal fat accumulation is similar to wild-type. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385. |
| AX1792 | dbEx721. | C. elegans | dbEx721 [npr-4::mCherry + unc-122p::GFP]. Pick GFP+ to maintain. mCherry expression in the AVA and RIV neurons, possibly in BAG, in the tail neuron PQR, and in the BDU neurons. Expression was also seen in the coelomocytes, the intestine, and the rectal gland cells. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385. |
| AX2061 | dbEx813. | C. elegans | dbEx813 [gcy-37p::cGi500]. Pick GFP+ animals to maintain. The cGi500 cGMP sensor is expressed in the oxygen-sensing AQR, PQR, and URX neurons. Reference: Couto A, et al. Proc Natl Acad Sci U S A. 2013 Aug 27;110(35):E3301-10. |
| AX2157 | tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx722. | C. elegans | dbEx722 [flp-17p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in BAG. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113. |
| AX2159 | tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx723. | C. elegans | dbEx723 [gcy-32p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AQR, PQR, and URX. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113. |
| AX2161 | tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx724. | C. elegans | dbEx724 [flp-6p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in ASE using an ASE-specific flp-6p fragment. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113. |
| AX2164 | tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx725. | C. elegans | dbEx725 [gcy-8p::tax-2(cDNA)::SL2::GFP + gcy-32p::tax-2(cDNA)::SL2::GFP+ flp-17p::tax-2(cDNA)::SL2::GFP + flp-6p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AFD, AQR, PQR, URX, BAG, and ASE. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113. |
| AX2178 | tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx726. | C. elegans | dbEx726 [gcy-8p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AFD. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113. |
| AX301 | npr-1(ad609) lin-15B&lin-15A(n765) X; dbEx35. | C. elegans | dbEx35 [npr-1::GFP + lin-15(+)]. Pick Non-Muv to maintain. Solitary feeders. GFP is expressed in approximately 20 neuron types. Reference: Coates JC, de Bono M. 2002 Nature 419: 925-929. |
| AX7884 | pod-2(syb1772[pod-2::His10]) II; mccc-1(syb1666[mccc-1::His10]) IV; pyc-1(syb1680[pyc-1::His10]) V; pcca-1(syb1626[pcca-1::His10]) X. | C. elegans | Superficially wild-type. Referred to as MP3-His. Strain can be used to biotinylated carboxylases from worm extracts. AX7884 obtained by crossing parental strains PHX1772 pod-2(syb1772[pod-2::His10]) II, PHX1666 mccc-1(syb1666[mccc-1::His10]) IV, PHX1680 pyc-1(syb1680[pyc-1::His10]) V and PHX1626 pcca-1(syb1626[pcca-1::His10]) X to obtain the quadruple His10-tagged strain. The 5xGlycine(G-linker)-His10 tag is a 45 bp sequence (GGAGGAGGAGGAGGACACCATCACCATCACCACCACCACCACCAC) encoding five glycine as a linker and ten histidine residues was knocked in at the C terminus-just upstream of the termination codon-of each of the four carboxylases. Reference: Artan M, et al. J Biol Chem. 2022 Aug 3:102343. doi: 10.1016/j.jbc.2022.102343. Epub ahead of print. PMID: 35933017. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| db42 | Allele | substitution | |
| db66 | Allele | substitution | nonsense |
| db99 | Allele |