Variation Information: ju1574

Nameju1574 View on WormBase
Species C. elegans
Genetic positionI:2.18 +/- 0.005 cM
Genomic positiongenomic coordinates unknown or not listed
Protein changeprotein change unknown or not listed

Strains carrying this variation

Strain Genotype Species Description
CZ25708 prg-1(ju1574) I. C. elegans Temperature sensitive sterility: maintain at 15-20C. prg-1(ju1574) mutant animals become sterile at the fifth generation grown at 25C. prg-1(ju1574) contains two mutations in the PIWI domain active site (RNaseH/slicer) [D583A, Y585A]. Mutation of the first conserved aspartate of the catalytic triad (D-D-H motif) to alanine (D583A) created an A-D-H motif which abolishes slicer activity in Argonaute proteins. WT: [GTCGGCTACGATCTGTACCACGACTCGACATTGAAAGGAAAAACT --> VGYDLYHDSTLKGKT] ju1574: [GTCGGCTACGcgCTGgctCAtGAtTCGACATTGAAAGGAAAAACT --> CGYALAHDSTLKGKT] Forward genotyping primer: GTAATGCTCGCTGACGACAA Reverse genotyping primer: TTGACGAACTGTGGAACCAA Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014.