Variation Information: gk5215
| Name | gk5215 View on WormBase |
|---|---|
| Species | C. elegans |
| Genetic position | genetic position unknown or not listed |
| Genomic position | genomic coordinates unknown or not listed |
| Protein change | protein change unknown or not listed |
Strains carrying this variation
| Strain | Genotype | Species | Description |
|---|---|---|---|
| VC4133 | hot-6(gk5215) V. | C. elegans | Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5215 mutation is G->A, flanking sequences CACCAATTGGATAAAAGAAAATATCAGTTT and AGTTGCAAGTTGTCGACGAACTGTTGCATT. |