Variation Information: gk5299

Namegk5299 View on WormBase
Species C. elegans
Genetic positiongenetic position unknown or not listed
Genomic positiongenomic coordinates unknown or not listed
Protein changeprotein change unknown or not listed

Strains carrying this variation

Strain Genotype Species Description
VC4213 tsp-19(gk5299) I. C. elegans Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5299 mutation is G->A, flanking sequences AAAAGTCATATAATGACATATGTAAACCCG and TGAGTGACGGATTGAATGAAGTCCATTATC.