Variation Information: gk5170
| Name | gk5170 View on WormBase |
|---|---|
| Species | C. elegans |
| Genetic position | genetic position unknown or not listed |
| Genomic position | genomic coordinates unknown or not listed |
| Protein change | protein change unknown or not listed |
Strains carrying this variation
| Strain | Genotype | Species | Description |
|---|---|---|---|
| VC4083 | tni-4(gk5170) IV. | C. elegans | Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5170 mutation is G->A, flanking sequences TCATTCCACTTCCAGATTTGGATAACGAAG and TAAGTGTTCTGAAGATGAAAACAACTATTT. |