Variation Information: gk5170
Name | gk5170 View on WormBase |
---|---|
Species | C. elegans |
Genetic position | genetic position unknown or not listed |
Genomic position | genomic coordinates unknown or not listed |
Protein change | protein change unknown or not listed |
Strains carrying this variation
Strain | Genotype | Species | Description |
---|---|---|---|
VC4083 | tni-4(gk5170) IV. | C. elegans | Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5170 mutation is G->A, flanking sequences TCATTCCACTTCCAGATTTGGATAACGAAG and TAAGTGTTCTGAAGATGAAAACAACTATTT. |