Caenorhabditis Genetics Center (CGC)

Variation Information: sy1086

Namesy1086 View on WormBase
Species C. elegans
Genetic positionI:-3.73 +/- 0.000 cM
Genomic positiongenomic coordinates unknown or not listed
Protein changeprotein change unknown or not listed

Strains carrying this variation

Strain Genotype Species Description
PS7783 K03E5.2(sy1086) I. C. elegans Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: aaaattttcagAAGCTGGCCTCAAAATTGCCGCCG Right flanking sequence: TCTCGAGGTGCCAAGCAATGAACAATTGGAGAGGAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTGCTTGGCACCTCGACGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616