Variation Information: gk5216

Namegk5216 View on WormBase
Species C. elegans
Genetic positiongenetic position unknown or not listed
Genomic positiongenomic coordinates unknown or not listed
Protein changeprotein change unknown or not listed

Strains carrying this variation

Strain Genotype Species Description
VC4134 ZK1225.1(gk5216) I. C. elegans Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5216 mutation is C->T, flanking sequences AAATACACTCTGGAATCATACGCATCAATT and GAAGATATTATCCTACCAACAAGTTTATTA.