Variation Information: gk5216
Name | gk5216 View on WormBase |
---|---|
Species | C. elegans |
Genetic position | genetic position unknown or not listed |
Genomic position | genomic coordinates unknown or not listed |
Protein change | protein change unknown or not listed |
Strains carrying this variation
Strain | Genotype | Species | Description |
---|---|---|---|
VC4134 | ZK1225.1(gk5216) I. | C. elegans | Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5216 mutation is C->T, flanking sequences AAATACACTCTGGAATCATACGCATCAATT and GAAGATATTATCCTACCAACAAGTTTATTA. |