Variation Information: gk5189
Name | gk5189 View on WormBase |
---|---|
Species | C. elegans |
Genetic position | genetic position unknown or not listed |
Genomic position | genomic coordinates unknown or not listed |
Protein change | protein change unknown or not listed |
Strains carrying this variation
Strain | Genotype | Species | Description |
---|---|---|---|
VC4112 | T03F6.10(gk5189) III. | C. elegans | Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5189 mutation is C->T, flanking sequences AATGAGAGCAATGAGAAGAAGCATAAAAAT and TGGAAATATAGAAATATACTTACTTTTAAG. |