Variation Information: ma354

Name	ma354 View on WormBase
Species	C. elegans
Genetic position	genetic position unknown or not listed
Genomic position	genomic coordinates unknown or not listed
Protein change	protein change unknown or not listed

Strains carrying this variation

Strain	Genotype	Species	Description
VT3500	wIs51 V; hbl-1(ma354) X.	C. elegans	wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Gain-of-function allele causing retarded heterochronic defects including extra seam cells and absence of alae in young adult animals. ms354 is a 1120 bp deletion removing most of the hbl-1 3'UTR including all let-7-complementary sites. Sequences flanking the deletion: TTCTAATCATGGCCAGTTTCTTGCA and GTGCGTTCTTCTGTCATCATGTACA. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111.