Variation Information: gk5244
Name | gk5244 View on WormBase |
---|---|
Species | C. elegans |
Genetic position | genetic position unknown or not listed |
Genomic position | genomic coordinates unknown or not listed |
Protein change | protein change unknown or not listed |
Strains carrying this variation
Strain | Genotype | Species | Description |
---|---|---|---|
VC4158 | AH9.1(gk5243) K09C4.10(gk5244) X. | C. elegans | Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5243 mutation is C->T, flanking sequences TTCAGTCCGACTGTTTTGTGATGGCTGTCT and CAGAACCAATTACGTTTGTCAATTTTCCGC. The gk5244 mutation is C->A, flanking sequences TGTCTGATCCTTTCTCAATAGTTCCATCCT and GCGCTTTTCAGCAATATGATTTTCAGATCC. |