Variation Information: gk5172

Namegk5172 View on WormBase
Species C. elegans
Genetic positiongenetic position unknown or not listed
Genomic positiongenomic coordinates unknown or not listed
Protein changeprotein change unknown or not listed

Strains carrying this variation

Strain Genotype Species Description
VC4084 T27E7.4(gk5171) IV; irk-2(gk5172) X. C. elegans Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5171 mutation is G->A, flanking sequences CTCTGATAATAAAACATTTGTAAAGTGTTC and AATGATATTTTTCGTTGCAGATTGTTTTTT. The gk5172 mutation is T->C, flanking sequences GACGCTTTCCACCACTCCTTCCAAAATTGC and GAAAATTTGAAAACATTTGGATTTTCTATT.