Variation Information: gk5191
| Name | gk5191 View on WormBase |
|---|---|
| Species | C. elegans |
| Genetic position | genetic position unknown or not listed |
| Genomic position | genomic coordinates unknown or not listed |
| Protein change | protein change unknown or not listed |
Strains carrying this variation
| Strain | Genotype | Species | Description |
|---|---|---|---|
| VC4113 | K12C11.6(gk5190) I; sre-40(gk5191) II. | C. elegans | Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5190 mutation is G->A, flanking sequences CAAAAATCGAGATGAGTTAGTAAGCCGGAG and TGAGTTAATCATACAAAATCAAAAAAAAAA. The gk5191 mutation is A->C, flanking sequences CCAATCTATAGCATAGTATAAAAATATTTC and TATTCTTGAAAGAAGTTATAATATTGCAGA. |