Variation Information: vr11

Namevr11 View on WormBase
Species C. elegans
Genetic positionX:15.44 +/- 0.000 cM
Genomic positionX: 13928235..13928640
Protein change Deletion

Strains carrying this variation

Strain Genotype Species Description
YL140 meg-1(vr11) X. C.elegans Maternal effect sterility at 25 degrees. Can be maintained at 20C. Deletion breakpoints: CAGTTCCAAATGAATCAAAG / CTGGCGGAAGACGATGCAAA Reference: Leacock SW & Reinke V. Genetics. 2008 Jan;178(1):295-306.