Variation Information: md259

Namemd259 View on WormBase
Species C. elegans
Genetic positionII:0.12 +/- 0.000 cM
Genomic positionII: 6815309..6815310
Protein change Deletion

Strains carrying this variation

Strain Genotype Species Description
RM1625 snt-1(md259) II. C. elegans snt-1(md259) is a 2-bp deletion in exon 6A. Breakpoints: tttcattttctggggtaattttcagatcct / / tgtgaagattgtgttgatgcaaggtggaaa. Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.