Variation Information: md220

Namemd220 View on WormBase
Species C. elegans
Genetic positionII:0.12 +/- 0.000 cM
Genomic positionII: 6814924..6814932
Protein change Deletion

Strains carrying this variation

Strain Genotype Species Description
RM1620 snt-1(md220) II. C. elegans snt-1(md220) is a 9-bp deletion in exon 5 removing V312-L314. Breakpoints: ggtacgtcccaactgctggtaaattgacag / / tggaagcaaaaaatcttaagaaaatggacg. Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.