Variation Information: gk5182
| Name | gk5182 View on WormBase |
|---|---|
| Species | C. elegans |
| Genetic position | II:0.84 +/- 0.000 cM |
| Genomic position | genomic coordinates unknown or not listed |
| Protein change | protein change unknown or not listed |
Strains carrying this variation
| Strain | Genotype | Species | Description |
|---|---|---|---|
| VC4092 | etc-1(gk5182) II. | C. elegans | Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5182 mutation is C->T, flanking sequences TCGTTCTTTCAGGAGACTATCAAAATGGCT and AGCTACTTGTCAATTTCTATGAAACGAATA. |