Variation Information: gk5205
| Name | gk5205 View on WormBase |
|---|---|
| Species | C. elegans |
| Genetic position | II:3.33 +/- 0.002 cM |
| Genomic position | genomic coordinates unknown or not listed |
| Protein change | protein change unknown or not listed |
Strains carrying this variation
| Strain | Genotype | Species | Description |
|---|---|---|---|
| VC4125 | ptr-13(gk5205) II. | C. elegans | Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5205 mutation is C->T, flanking sequences CAGAGGATACGATAGATTGACCCCAGGCAT and CATTCGATTGCAAGTAGTTTCTAAACCAGT. |