Variation Information: gk5205

Namegk5205 View on WormBase
Species C. elegans
Genetic positionII:3.33 +/- 0.002 cM
Genomic positiongenomic coordinates unknown or not listed
Protein changeprotein change unknown or not listed

Strains carrying this variation

Strain Genotype Species Description
VC4125 ptr-13(gk5205) II. C. elegans Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5205 mutation is C->T, flanking sequences CAGAGGATACGATAGATTGACCCCAGGCAT and CATTCGATTGCAAGTAGTTTCTAAACCAGT.