Variation Information: gk5204

Namegk5204 View on WormBase
Species C. elegans
Genetic positionX:1.97 +/- 0.000 cM
Genomic positiongenomic coordinates unknown or not listed
Protein changeprotein change unknown or not listed

Strains carrying this variation

Strain Genotype Species Description
VC4124 R07E3.7(gk5204) X. C. elegans Homozygous viable. Nonsense allele identified by amplicon sequencing.The gk5204 mutation is A->T, flanking sequences TGGAGGTTGCTTTTTGTCTTTTGATCGTAT and CAGAAAAATAGGATGAGAATCAACAGAACG.