Variation Information: gk5185
| Name | gk5185 View on WormBase |
|---|---|
| Species | C. elegans |
| Genetic position | V:0.30 +/- 0.006 cM |
| Genomic position | genomic coordinates unknown or not listed |
| Protein change | protein change unknown or not listed |
Strains carrying this variation
| Strain | Genotype | Species | Description |
|---|---|---|---|
| VC4094 | col-141(gk5185) V. | C. elegans | Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5185 mutation is T->G, flanking sequences GATGATCTTCAACGACATCAACTCATTCTA and GATGAAAAGATTGAGGAGCTCAATGAGTTC. |