Variation Information: gk5198
| Name | gk5198 View on WormBase |
|---|---|
| Species | C. elegans |
| Genetic position | IV:16.52 +/- 0.000 cM |
| Genomic position | genomic coordinates unknown or not listed |
| Protein change | protein change unknown or not listed |
Strains carrying this variation
| Strain | Genotype | Species | Description |
|---|---|---|---|
| VC4119 | clec-199(gk5198) IV. | C. elegans | Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5198 mutation is G->A, flanking sequences AATTAAAAAATGTTTAATACCACCTATTCA and ACAGCAAAAACTACAAAGTCCACGACAACC. |