Variation Information: tm9708

Nametm9708 View on WormBase
Species C. elegans
Genetic positionIV:1.78 +/- 0.002 cM
Genomic positiongenomic coordinates unknown or not listed
Protein changeprotein change unknown or not listed

Strains carrying this variation

Strain Genotype Species Description
FX30257 tmC25 [unc-5(tm9708)] IV. C. elegans Break points: In(mak-2 unc-8 In(kvs-5 dmd-9)) IV. Covered region (Mb) 6.5 (0.7..7.2) Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
RG3115 vha-11(ve615[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)]. C. elegans Homozygous Emb. Deletion of 5698 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, non-GFP unc-5(tm9708) homozygotes, and GFP+ dead embryos(ve615).
RG3193 cct-8(ve693[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)] IV. C. elegans Homozygous larval lethal. Deletion of 5958 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ dead larvae (ve693 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: CACGTGGTTTTGGTCCTCCAGTCGCCTGCT ; Right flanking sequence: CGGTTCCTTTGAAGTGCTGAGCTCCTTCCT. sgRNA #1: TCAGATTATTATGTCAAAGC; sgRNA #2: GCACTTCAAAGGAACCGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3197 Y54G2A.75(ve697[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)] IV. C. elegans Homozygous larval lethal. Deletion of 635 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ dead larvae (ve697 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: ccgaaatgccgcatcgcgtgttgtttagcc; Right flanking sequence: TGGAGCTCGTAAAGGACGTGGTCTTGTCAT. sgRNA #1: atcgcgtgttgtttagccag; sgRNA #2: ATCATCGAGACGGTCTATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.