Variation Information: ma292
Name | ma292 View on WormBase |
---|---|
Species | C. elegans |
Genetic position | X:15.05 +/- 0.000 cM |
Genomic position | genomic coordinates unknown or not listed |
Protein change | protein change unknown or not listed |
Strains carrying this variation
Strain | Genotype | Species | Description |
---|---|---|---|
VT3297 | maIs105 V; mir-793(ma292) X. | C. elegans | maIs105 [col-19::GFP] V. mir-793(ma292) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma292 allele is missing the 220 nucleotide region between ACCGAGCAAGTTAGAAATCACCGCC and GTATGAATGTTTTTCCTTCAAACAT [chrX:13,857,855-13,858,124 of WBcel235/ce11]. |