Variation Information: ax2037
Name | ax2037 View on WormBase |
---|---|
Species | C. elegans |
Genetic position | IV:4.53 +/- 0.000 cM |
Genomic position | genomic coordinates unknown or not listed |
Protein change | Insertion |
Strains carrying this variation
Strain | Genotype | Species | Description |
---|---|---|---|
JH3184 | gtbp-1(ax2037([gtbp-1::Myc]) IV. | C. elegans | Maintain at 20-25C. ax2037 was produced by mutation of the sgRNA site and insertion of Myc tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence CAGATCCTCTTCTGATATCAGTTTTTGTTCATTTTGTCCCGCATTTTGGAAACCGCTAC GCATTCCTCCACGC between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23. |