Variation Information: ax2037

Nameax2037 View on WormBase
Species C. elegans
Genetic positionIV:4.53 +/- 0.000 cM
Genomic positiongenomic coordinates unknown or not listed
Protein change Insertion

Strains carrying this variation

Strain Genotype Species Description
JH3184 gtbp-1(ax2037([gtbp-1::Myc]) IV. C. elegans Maintain at 20-25C. ax2037 was produced by mutation of the sgRNA site and insertion of Myc tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence CAGATCCTCTTCTGATATCAGTTTTTGTTCATTTTGTCCCGCATTTTGGAAACCGCTAC GCATTCCTCCACGC between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23.