Variation Information: gk5208

Name	gk5208 View on WormBase
Species	C. elegans
Genetic position	III:-4.25 +/- 0.000 cM
Genomic position	genomic coordinates unknown or not listed
Protein change	protein change unknown or not listed

Strains carrying this variation

Strain	Genotype	Species	Description
VC4126	Y39G10AR.15(gk5206) ZC334.7(gk5207) I; cnnm-5(gk5208) III.	C. elegans	Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5206 mutation is T->A, flanking sequences GGCCTTTCCAACTTAGAATTTTGGTCGTCC and GAAAAATAACGAAGTTATGGTGAACTCCCT. The gk5207 mutation is C->T, flanking sequences CCTGAGATCAAATGTACAAATTTTCAGGCC and GACGCTACCCGGTAATGATGTACACCCTGA. The gk5208 mutation is T->A, flanking sequences CAATCGTGATGATTCCGACTACTTTCGAGC and GAAATTTGGTGAAACTTTAGGGCTACAATG.
VC4127	ZC334.7(gk5207) I; cnnm-5(gk5208) III; K08H2.10(gk5209) X.	C. elegans	Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5207 mutation is C->T, flanking sequences CCTGAGATCAAATGTACAAATTTTCAGGCC and GACGCTACCCGGTAATGATGTACACCCTGA. The gk5208 mutation is T->A, flanking sequences CAATCGTGATGATTCCGACTACTTTCGAGC and GAAATTTGGTGAAACTTTAGGGCTACAATG. The gk5209 mutation is G->T, flanking sequences AAAAAGGAAGACATTGAGTTTGAGGATACA and AACGTCGAATTCATTCTCGAAGTGTTCGAA.