Variation Information: gk5036
| Name | gk5036 View on WormBase |
|---|---|
| Species | C. elegans |
| Genetic position | genetic position unknown or not listed |
| Genomic position | genomic coordinates unknown or not listed |
| Protein change | Deletion |
Strains carrying this variation
| Strain | Genotype | Species | Description |
|---|---|---|---|
| VC3958 | asd-2(gk5036[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | C. elegans | Homozygous viable. Deletion of 3065 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGTTGAACCCGAACCCGCAAGCACCACCC; Right flanking sequence: GGTGGGAGAACCAGAAACGTGTAAATCGAC. See WormBase Variation gk5036 for details. |