Variation Information: fj54

Namefj54 View on WormBase
Species C. elegans
Genetic positionIV:3.51 +/- 0.000 cM
Genomic positionIV: 7958652..7959175
Protein changeF20D12.1a F20D12.1a F20D12.1b F57H12.4 Deletion

Strains carrying this variation

Strain Genotype Species Description
ZT3 csr-1(fj54) IV/nT1 [qIs51] (IV;V). C. elegans Heterozygotes are WT and GFP+. csr-1 homozygotes are basically sterile, but some of them occasionally lay a small number of dead eggs. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. Homozygous nT1[qIs51] inviable.